Incidental Mutation 'R1349:Tgm1'
ID156621
Institutional Source Beutler Lab
Gene Symbol Tgm1
Ensembl Gene ENSMUSG00000022218
Gene Nametransglutaminase 1, K polypeptide
SynonymsTG K, TGase 1, protein-glutamine-gamma-glutamyltransferase, K polypeptide, 2310004J08Rik
MMRRC Submission 039414-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.907) question?
Stock #R1349 (G1)
Quality Score188
Status Validated
Chromosome14
Chromosomal Location55700009-55713926 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 55711201 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002389] [ENSMUST00000062861] [ENSMUST00000168729] [ENSMUST00000169237] [ENSMUST00000178034] [ENSMUST00000226907] [ENSMUST00000227061] [ENSMUST00000227958] [ENSMUST00000228123]
Predicted Effect probably benign
Transcript: ENSMUST00000002389
SMART Domains Protein: ENSMUSP00000002389
Gene: ENSMUSG00000022218

DomainStartEndE-ValueType
low complexity region 13 45 N/A INTRINSIC
low complexity region 50 63 N/A INTRINSIC
low complexity region 65 95 N/A INTRINSIC
Pfam:Transglut_N 109 228 5.5e-35 PFAM
TGc 368 461 1.7e-43 SMART
low complexity region 550 561 N/A INTRINSIC
Pfam:Transglut_C 578 682 1.5e-22 PFAM
Pfam:Transglut_C 690 787 1e-20 PFAM
low complexity region 788 804 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000062861
SMART Domains Protein: ENSMUSP00000061498
Gene: ENSMUSG00000040472

DomainStartEndE-ValueType
Pfam:PPTA 47 77 2.9e-8 PFAM
Pfam:PPTA 91 121 2e-12 PFAM
Pfam:PPTA 127 156 7.6e-11 PFAM
Pfam:PPTA 162 192 3.8e-12 PFAM
Pfam:PPTA 210 240 7.8e-12 PFAM
Pfam:RabGGT_insert 243 346 5.3e-47 PFAM
LRR 462 485 1.62e0 SMART
LRR 507 531 1.03e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168729
SMART Domains Protein: ENSMUSP00000128090
Gene: ENSMUSG00000022218

DomainStartEndE-ValueType
low complexity region 13 45 N/A INTRINSIC
low complexity region 50 63 N/A INTRINSIC
low complexity region 65 95 N/A INTRINSIC
Pfam:Transglut_N 109 228 5.5e-35 PFAM
TGc 368 461 1.7e-43 SMART
low complexity region 550 561 N/A INTRINSIC
Pfam:Transglut_C 578 682 1.5e-22 PFAM
Pfam:Transglut_C 690 787 1e-20 PFAM
low complexity region 788 804 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169237
SMART Domains Protein: ENSMUSP00000133032
Gene: ENSMUSG00000040472

DomainStartEndE-ValueType
Pfam:PPTA 92 119 3.6e-12 PFAM
Pfam:PPTA 128 154 1.2e-10 PFAM
Pfam:PPTA 163 190 2e-11 PFAM
Pfam:PPTA 211 238 9e-12 PFAM
Pfam:RabGGT_insert 244 346 1.9e-46 PFAM
LRR 462 485 1.62e0 SMART
LRR 507 531 1.03e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178034
SMART Domains Protein: ENSMUSP00000137642
Gene: ENSMUSG00000022218

DomainStartEndE-ValueType
low complexity region 13 45 N/A INTRINSIC
low complexity region 50 63 N/A INTRINSIC
low complexity region 65 95 N/A INTRINSIC
Pfam:Transglut_N 110 226 1.2e-32 PFAM
TGc 368 461 1.7e-43 SMART
low complexity region 550 561 N/A INTRINSIC
Pfam:Transglut_C 578 682 3.6e-24 PFAM
Pfam:Transglut_C 690 787 1.3e-20 PFAM
low complexity region 788 804 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000226907
Predicted Effect probably benign
Transcript: ENSMUST00000227061
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227106
Predicted Effect probably benign
Transcript: ENSMUST00000227958
Predicted Effect probably benign
Transcript: ENSMUST00000228123
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228604
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228826
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.8%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein that catalyzes the addition of an alkyl group from an akylamine to a glutamine residue of a protein, forming an alkylglutamine in the protein. This protein alkylation leads to crosslinking of proteins and catenation of polyamines to proteins. This gene contains either one or two copies of a 22 nt repeat unit in its 3' UTR. Mutations in this gene have been associated with autosomal recessive lamellar ichthyosis (LI) and nonbullous congenital ichthyosiform erythroderma (NCIE). [provided by RefSeq, Jul 2008]
PHENOTYPE: Newborn mice homozygous for a knock-out allele are small and hypoactive and die within hours of birth displaying failure to suckle, progressive dehydration, and epidermal defects including a reddish, tight and wrinkled skin, hyperkeratosis, and impaired skin barrier function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik G A 8: 124,861,253 T36I possibly damaging Het
Adcy2 T A 13: 68,668,533 N778I probably damaging Het
Ak5 G T 3: 152,533,434 D301E probably damaging Het
Akap13 G A 7: 75,609,592 G655S possibly damaging Het
Ankrd28 A T 14: 31,745,261 M248K probably benign Het
Atf7ip2 G A 16: 10,234,331 V225I probably damaging Het
Ccdc151 C T 9: 21,993,620 R290H probably damaging Het
Ccdc157 A T 11: 4,149,056 I48N probably benign Het
Cd209d C A 8: 3,878,515 probably benign Het
Cecr2 G A 6: 120,757,603 G613E probably damaging Het
Clspn C T 4: 126,563,977 A98V probably benign Het
Cntnap5b G A 1: 100,164,088 D499N probably benign Het
Cox7a2 G A 9: 79,758,537 R21* probably null Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Dbpht2 C CNNNNNNNNNNNNNNNNNN 12: 74,299,062 noncoding transcript Het
Dlg1 T C 16: 31,812,820 I208T probably damaging Het
Dmxl1 A T 18: 49,888,853 N1612Y probably damaging Het
Epha3 A G 16: 63,611,053 I495T possibly damaging Het
Frem1 T C 4: 82,922,305 probably benign Het
Glipr1 A G 10: 111,993,532 V108A probably benign Het
Gm4778 A G 3: 94,266,128 T148A possibly damaging Het
Gpatch2l T C 12: 86,260,709 L287P possibly damaging Het
Hp T G 8: 109,575,306 K337Q probably benign Het
Htr1a T A 13: 105,445,366 C371* probably null Het
Leo1 T C 9: 75,449,469 V377A possibly damaging Het
Lsg1 A G 16: 30,564,654 F583L possibly damaging Het
Map4k4 C A 1: 40,021,159 P1103Q probably damaging Het
Mybph T C 1: 134,193,615 S38P probably benign Het
Myo1e T G 9: 70,287,069 probably benign Het
Nefh T TNNNNNNNNNNNNNNNNNN 11: 4,941,010 probably benign Het
Oca2 T A 7: 56,535,968 M814K probably benign Het
Pkd1 T C 17: 24,575,266 C1976R probably damaging Het
Pogz T A 3: 94,860,888 L126M probably damaging Het
Rec8 T C 14: 55,618,974 Y68H probably damaging Het
Ryr3 T A 2: 112,834,201 S1582C probably damaging Het
Sh3pxd2a A T 19: 47,267,721 W853R probably damaging Het
Slc6a7 C T 18: 61,000,543 G527D probably benign Het
Tnxb T C 17: 34,710,293 V2770A possibly damaging Het
Togaram1 T A 12: 65,011,145 M1502K probably damaging Het
Vmn1r11 G A 6: 57,137,978 C209Y probably benign Het
Vmn2r102 A T 17: 19,660,625 probably benign Het
Vmn2r12 T C 5: 109,086,586 M587V probably benign Het
Vmn2r63 A G 7: 42,929,218 F84L possibly damaging Het
Wdr35 A T 12: 9,019,870 probably benign Het
Wdr73 C A 7: 80,893,252 V176L probably damaging Het
Other mutations in Tgm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02206:Tgm1 APN 14 55704935 missense possibly damaging 0.92
IGL02934:Tgm1 APN 14 55709989 missense probably damaging 1.00
IGL03243:Tgm1 APN 14 55705907 missense probably damaging 0.98
IGL03282:Tgm1 APN 14 55711070 missense probably damaging 1.00
PIT4458001:Tgm1 UTSW 14 55712565 missense unknown
R0277:Tgm1 UTSW 14 55710927 unclassified probably benign
R0277:Tgm1 UTSW 14 55712652 unclassified probably benign
R0478:Tgm1 UTSW 14 55700334 nonsense probably null
R1594:Tgm1 UTSW 14 55709519 missense probably damaging 0.96
R1776:Tgm1 UTSW 14 55709397 missense probably damaging 0.99
R1852:Tgm1 UTSW 14 55704941 missense probably damaging 1.00
R1988:Tgm1 UTSW 14 55705577 missense probably benign 0.00
R2064:Tgm1 UTSW 14 55709471 missense probably damaging 1.00
R2139:Tgm1 UTSW 14 55709543 missense probably damaging 1.00
R2427:Tgm1 UTSW 14 55712100 critical splice donor site probably null
R3710:Tgm1 UTSW 14 55712595 unclassified probably benign
R3917:Tgm1 UTSW 14 55712757 splice site probably benign
R4697:Tgm1 UTSW 14 55705681 missense probably benign 0.05
R4804:Tgm1 UTSW 14 55705619 missense probably benign 0.38
R5074:Tgm1 UTSW 14 55709935 missense probably damaging 1.00
R5341:Tgm1 UTSW 14 55700248 missense possibly damaging 0.90
R5346:Tgm1 UTSW 14 55711172 missense probably damaging 0.99
R5557:Tgm1 UTSW 14 55705643 missense probably benign 0.10
R5566:Tgm1 UTSW 14 55712436 missense probably damaging 0.99
R5828:Tgm1 UTSW 14 55705554 missense probably benign 0.38
R6802:Tgm1 UTSW 14 55712482 unclassified probably benign
R7017:Tgm1 UTSW 14 55704941 missense possibly damaging 0.76
R7094:Tgm1 UTSW 14 55704843 missense possibly damaging 0.53
R7549:Tgm1 UTSW 14 55705903 missense probably benign 0.02
R7731:Tgm1 UTSW 14 55710521 missense probably benign 0.21
R7799:Tgm1 UTSW 14 55712475 missense unknown
R7915:Tgm1 UTSW 14 55700426 missense probably damaging 0.98
R7956:Tgm1 UTSW 14 55708895 missense probably benign 0.01
R8098:Tgm1 UTSW 14 55710534 missense probably damaging 1.00
R8190:Tgm1 UTSW 14 55704884 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTATGACCAGATGTCCAGACACC -3'
(R):5'- CACCAAGCTGCCCTAAGGAAGATTG -3'

Sequencing Primer
(F):5'- ATCTCATTGCGGGGGTCAAAG -3'
(R):5'- TGCCCTAAGGAAGATTGTCACAG -3'
Posted On2014-02-11