Incidental Mutation 'R1349:Atf7ip2'
ID156622
Institutional Source Beutler Lab
Gene Symbol Atf7ip2
Ensembl Gene ENSMUSG00000039200
Gene Nameactivating transcription factor 7 interacting protein 2
Synonyms4930558K11Rik, PSM2, Get-1
MMRRC Submission 039414-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R1349 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location10192712-10251478 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 10234331 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 225 (V225I)
Ref Sequence ENSEMBL: ENSMUSP00000113480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044005] [ENSMUST00000117220] [ENSMUST00000119023] [ENSMUST00000230872]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044005
AA Change: V225I

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000036731
Gene: ENSMUSG00000039200
AA Change: V225I

DomainStartEndE-ValueType
Pfam:ATF7IP_BD 59 270 4.7e-75 PFAM
low complexity region 322 336 N/A INTRINSIC
FN3 346 435 7.55e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000117220
AA Change: V225I

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113573
Gene: ENSMUSG00000039200
AA Change: V225I

DomainStartEndE-ValueType
low complexity region 180 192 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119023
AA Change: V225I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113480
Gene: ENSMUSG00000039200
AA Change: V225I

DomainStartEndE-ValueType
low complexity region 180 192 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158938
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229819
Predicted Effect possibly damaging
Transcript: ENSMUST00000230872
AA Change: V8I

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.0661 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.8%
Validation Efficiency 98% (46/47)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik G A 8: 124,861,253 T36I possibly damaging Het
Adcy2 T A 13: 68,668,533 N778I probably damaging Het
Ak5 G T 3: 152,533,434 D301E probably damaging Het
Akap13 G A 7: 75,609,592 G655S possibly damaging Het
Ankrd28 A T 14: 31,745,261 M248K probably benign Het
Ccdc151 C T 9: 21,993,620 R290H probably damaging Het
Ccdc157 A T 11: 4,149,056 I48N probably benign Het
Cd209d C A 8: 3,878,515 probably benign Het
Cecr2 G A 6: 120,757,603 G613E probably damaging Het
Clspn C T 4: 126,563,977 A98V probably benign Het
Cntnap5b G A 1: 100,164,088 D499N probably benign Het
Cox7a2 G A 9: 79,758,537 R21* probably null Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Dbpht2 C CNNNNNNNNNNNNNNNNNN 12: 74,299,062 noncoding transcript Het
Dlg1 T C 16: 31,812,820 I208T probably damaging Het
Dmxl1 A T 18: 49,888,853 N1612Y probably damaging Het
Epha3 A G 16: 63,611,053 I495T possibly damaging Het
Frem1 T C 4: 82,922,305 probably benign Het
Glipr1 A G 10: 111,993,532 V108A probably benign Het
Gm4778 A G 3: 94,266,128 T148A possibly damaging Het
Gpatch2l T C 12: 86,260,709 L287P possibly damaging Het
Hp T G 8: 109,575,306 K337Q probably benign Het
Htr1a T A 13: 105,445,366 C371* probably null Het
Leo1 T C 9: 75,449,469 V377A possibly damaging Het
Lsg1 A G 16: 30,564,654 F583L possibly damaging Het
Map4k4 C A 1: 40,021,159 P1103Q probably damaging Het
Mybph T C 1: 134,193,615 S38P probably benign Het
Myo1e T G 9: 70,287,069 probably benign Het
Nefh T TNNNNNNNNNNNNNNNNNN 11: 4,941,010 probably benign Het
Oca2 T A 7: 56,535,968 M814K probably benign Het
Pkd1 T C 17: 24,575,266 C1976R probably damaging Het
Pogz T A 3: 94,860,888 L126M probably damaging Het
Rec8 T C 14: 55,618,974 Y68H probably damaging Het
Ryr3 T A 2: 112,834,201 S1582C probably damaging Het
Sh3pxd2a A T 19: 47,267,721 W853R probably damaging Het
Slc6a7 C T 18: 61,000,543 G527D probably benign Het
Tgm1 A G 14: 55,711,201 probably benign Het
Tnxb T C 17: 34,710,293 V2770A possibly damaging Het
Togaram1 T A 12: 65,011,145 M1502K probably damaging Het
Vmn1r11 G A 6: 57,137,978 C209Y probably benign Het
Vmn2r102 A T 17: 19,660,625 probably benign Het
Vmn2r12 T C 5: 109,086,586 M587V probably benign Het
Vmn2r63 A G 7: 42,929,218 F84L possibly damaging Het
Wdr35 A T 12: 9,019,870 probably benign Het
Wdr73 C A 7: 80,893,252 V176L probably damaging Het
Other mutations in Atf7ip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01926:Atf7ip2 APN 16 10241885 missense probably damaging 0.99
IGL01937:Atf7ip2 APN 16 10241537 splice site probably null
IGL02301:Atf7ip2 APN 16 10211047 missense probably benign 0.32
R0575:Atf7ip2 UTSW 16 10237211 missense probably damaging 1.00
R0671:Atf7ip2 UTSW 16 10241879 missense possibly damaging 0.86
R1119:Atf7ip2 UTSW 16 10240612 missense possibly damaging 0.83
R1182:Atf7ip2 UTSW 16 10241835 missense possibly damaging 0.93
R1302:Atf7ip2 UTSW 16 10240608 missense possibly damaging 0.84
R1346:Atf7ip2 UTSW 16 10234331 missense probably damaging 1.00
R1372:Atf7ip2 UTSW 16 10234331 missense probably damaging 1.00
R1672:Atf7ip2 UTSW 16 10209141 missense probably damaging 1.00
R1696:Atf7ip2 UTSW 16 10234331 missense probably damaging 1.00
R1897:Atf7ip2 UTSW 16 10211084 missense probably damaging 0.97
R1932:Atf7ip2 UTSW 16 10241703 missense possibly damaging 0.86
R2143:Atf7ip2 UTSW 16 10240645 missense probably null 0.68
R4612:Atf7ip2 UTSW 16 10241563 missense probably benign 0.33
R4732:Atf7ip2 UTSW 16 10241886 missense possibly damaging 0.92
R4733:Atf7ip2 UTSW 16 10241886 missense possibly damaging 0.92
R4934:Atf7ip2 UTSW 16 10241583 missense possibly damaging 0.72
R6137:Atf7ip2 UTSW 16 10201411 missense probably damaging 0.99
R6432:Atf7ip2 UTSW 16 10204670 missense probably damaging 1.00
R7298:Atf7ip2 UTSW 16 10209168 missense possibly damaging 0.82
R7517:Atf7ip2 UTSW 16 10241535 splice site probably null
R7744:Atf7ip2 UTSW 16 10241658 missense possibly damaging 0.93
R8124:Atf7ip2 UTSW 16 10209135 missense possibly damaging 0.67
R8245:Atf7ip2 UTSW 16 10201398 missense possibly damaging 0.93
U24488:Atf7ip2 UTSW 16 10204673 missense probably damaging 0.96
X0062:Atf7ip2 UTSW 16 10209274 splice site probably null
Z1177:Atf7ip2 UTSW 16 10241640 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- TTCTCACATGTTGTCCCGAACTCAAA -3'
(R):5'- ACAGTAATGAAGCAAAAGGCCCTAAACT -3'

Sequencing Primer
(F):5'- CAGAAATTAGAGGAGTTGTGACC -3'
(R):5'- actcagataaacacacataacagac -3'
Posted On2014-02-11