Incidental Mutation 'R1349:Slc6a7'
ID156631
Institutional Source Beutler Lab
Gene Symbol Slc6a7
Ensembl Gene ENSMUSG00000052026
Gene Namesolute carrier family 6 (neurotransmitter transporter, L-proline), member 7
SynonymsProt
MMRRC Submission 039414-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R1349 (G1)
Quality Score138
Status Validated
Chromosome18
Chromosomal Location60995381-61014199 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 61000543 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 527 (G527D)
Ref Sequence ENSEMBL: ENSMUSP00000025520 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025520]
Predicted Effect probably benign
Transcript: ENSMUST00000025520
AA Change: G527D

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000025520
Gene: ENSMUSG00000052026
AA Change: G527D

DomainStartEndE-ValueType
Pfam:SNF 37 561 1.2e-231 PFAM
low complexity region 623 634 N/A INTRINSIC
Meta Mutation Damage Score 0.0958 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.8%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the gamma-aminobutyric acid (GABA) neurotransmitter gene family and encodes a high-affinity mammalian brain L-proline transporter protein. This transporter protein differs from other sodium-dependent plasma membrane carriers by its pharmacological specificity, kinetic properties, and ionic requirements. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik G A 8: 124,861,253 T36I possibly damaging Het
Adcy2 T A 13: 68,668,533 N778I probably damaging Het
Ak5 G T 3: 152,533,434 D301E probably damaging Het
Akap13 G A 7: 75,609,592 G655S possibly damaging Het
Ankrd28 A T 14: 31,745,261 M248K probably benign Het
Atf7ip2 G A 16: 10,234,331 V225I probably damaging Het
Ccdc151 C T 9: 21,993,620 R290H probably damaging Het
Ccdc157 A T 11: 4,149,056 I48N probably benign Het
Cd209d C A 8: 3,878,515 probably benign Het
Cecr2 G A 6: 120,757,603 G613E probably damaging Het
Clspn C T 4: 126,563,977 A98V probably benign Het
Cntnap5b G A 1: 100,164,088 D499N probably benign Het
Cox7a2 G A 9: 79,758,537 R21* probably null Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Dbpht2 C CNNNNNNNNNNNNNNNNNN 12: 74,299,062 noncoding transcript Het
Dlg1 T C 16: 31,812,820 I208T probably damaging Het
Dmxl1 A T 18: 49,888,853 N1612Y probably damaging Het
Epha3 A G 16: 63,611,053 I495T possibly damaging Het
Frem1 T C 4: 82,922,305 probably benign Het
Glipr1 A G 10: 111,993,532 V108A probably benign Het
Gm4778 A G 3: 94,266,128 T148A possibly damaging Het
Gpatch2l T C 12: 86,260,709 L287P possibly damaging Het
Hp T G 8: 109,575,306 K337Q probably benign Het
Htr1a T A 13: 105,445,366 C371* probably null Het
Leo1 T C 9: 75,449,469 V377A possibly damaging Het
Lsg1 A G 16: 30,564,654 F583L possibly damaging Het
Map4k4 C A 1: 40,021,159 P1103Q probably damaging Het
Mybph T C 1: 134,193,615 S38P probably benign Het
Myo1e T G 9: 70,287,069 probably benign Het
Nefh T TNNNNNNNNNNNNNNNNNN 11: 4,941,010 probably benign Het
Oca2 T A 7: 56,535,968 M814K probably benign Het
Pkd1 T C 17: 24,575,266 C1976R probably damaging Het
Pogz T A 3: 94,860,888 L126M probably damaging Het
Rec8 T C 14: 55,618,974 Y68H probably damaging Het
Ryr3 T A 2: 112,834,201 S1582C probably damaging Het
Sh3pxd2a A T 19: 47,267,721 W853R probably damaging Het
Tgm1 A G 14: 55,711,201 probably benign Het
Tnxb T C 17: 34,710,293 V2770A possibly damaging Het
Togaram1 T A 12: 65,011,145 M1502K probably damaging Het
Vmn1r11 G A 6: 57,137,978 C209Y probably benign Het
Vmn2r102 A T 17: 19,660,625 probably benign Het
Vmn2r12 T C 5: 109,086,586 M587V probably benign Het
Vmn2r63 A G 7: 42,929,218 F84L possibly damaging Het
Wdr35 A T 12: 9,019,870 probably benign Het
Wdr73 C A 7: 80,893,252 V176L probably damaging Het
Other mutations in Slc6a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Slc6a7 APN 18 61001609 missense possibly damaging 0.88
IGL00433:Slc6a7 APN 18 61001291 critical splice donor site probably null
IGL01391:Slc6a7 APN 18 61003310 missense probably damaging 1.00
IGL01476:Slc6a7 APN 18 61005773 missense probably damaging 1.00
IGL02705:Slc6a7 APN 18 61009428 missense probably damaging 1.00
R0106:Slc6a7 UTSW 18 61002223 missense probably benign 0.04
R0106:Slc6a7 UTSW 18 61002223 missense probably benign 0.04
R0147:Slc6a7 UTSW 18 61002111 splice site probably benign
R0267:Slc6a7 UTSW 18 60996711 missense probably benign 0.00
R1498:Slc6a7 UTSW 18 60996692 missense probably benign 0.02
R1874:Slc6a7 UTSW 18 61001398 splice site probably benign
R2005:Slc6a7 UTSW 18 61001641 missense possibly damaging 0.68
R3051:Slc6a7 UTSW 18 61009517 missense probably damaging 0.96
R3970:Slc6a7 UTSW 18 61003345 missense possibly damaging 0.94
R4573:Slc6a7 UTSW 18 61002181 missense probably benign 0.20
R4835:Slc6a7 UTSW 18 61002205 missense probably benign 0.04
R4942:Slc6a7 UTSW 18 61004517 missense probably damaging 1.00
R5112:Slc6a7 UTSW 18 61007376 missense probably null 0.04
R5426:Slc6a7 UTSW 18 61003236 splice site probably null
R6168:Slc6a7 UTSW 18 61001662 missense probably benign 0.18
R6312:Slc6a7 UTSW 18 61002385 missense probably benign 0.12
R6489:Slc6a7 UTSW 18 61007543 missense probably damaging 1.00
R7131:Slc6a7 UTSW 18 61002202 missense probably damaging 1.00
R7460:Slc6a7 UTSW 18 61001602 missense probably benign 0.02
R7556:Slc6a7 UTSW 18 61007442 nonsense probably null
R7740:Slc6a7 UTSW 18 61000423 missense possibly damaging 0.90
R7793:Slc6a7 UTSW 18 61005779 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTAACCGAGAGCTGGGCCAC -3'
(R):5'- AGCTGGGCTGTCACAAACCTTC -3'

Sequencing Primer
(F):5'- CCACAGAGCCAGAAGGCTG -3'
(R):5'- CTTCATATCAAGTCAGCATGGAGC -3'
Posted On2014-02-11