Incidental Mutation 'R1351:Defb26'
ID156637
Institutional Source Beutler Lab
Gene Symbol Defb26
Ensembl Gene ENSMUSG00000074680
Gene Namedefensin beta 26
SynonymsEG654457
MMRRC Submission 039416-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R1351 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location152507798-152511692 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 152507817 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 181 (M181K)
Ref Sequence ENSEMBL: ENSMUSP00000096811 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099205]
Predicted Effect unknown
Transcript: ENSMUST00000099205
AA Change: M181K
SMART Domains Protein: ENSMUSP00000096811
Gene: ENSMUSG00000074680
AA Change: M181K

DomainStartEndE-ValueType
Pfam:Defensin_beta_2 28 58 2.7e-10 PFAM
internal_repeat_1 101 133 1.35e-13 PROSPERO
internal_repeat_1 129 161 1.35e-13 PROSPERO
low complexity region 162 168 N/A INTRINSIC
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef26 A G 3: 62,380,841 E444G probably damaging Het
Astl G A 2: 127,347,185 V144M possibly damaging Het
AW146154 A T 7: 41,480,454 C413S probably damaging Het
Bicdl2 G A 17: 23,667,545 probably benign Het
Cacna1h G T 17: 25,391,951 S624R probably benign Het
Car9 G T 4: 43,512,439 probably null Het
Cep126 C T 9: 8,100,086 E816K probably damaging Het
Cyp2j13 T C 4: 96,056,918 K291R probably benign Het
Dicer1 G A 12: 104,729,142 R177C probably damaging Het
Eif4g2 A G 7: 111,074,080 Y831H probably damaging Het
Ermap C T 4: 119,181,361 probably null Het
Fcamr C T 1: 130,813,020 T392I possibly damaging Het
Fgf3 T C 7: 144,840,780 probably benign Het
Gpr162 T C 6: 124,861,198 Y163C probably damaging Het
Gprc5d T C 6: 135,116,232 R226G possibly damaging Het
Hapln3 A C 7: 79,121,960 S60R probably damaging Het
Hif1a T C 12: 73,940,461 S443P probably benign Het
Irf2bpl A G 12: 86,882,624 M425T probably benign Het
Lrrc39 G T 3: 116,565,820 A5S possibly damaging Het
Mbtps1 A G 8: 119,518,162 L850S possibly damaging Het
Mios T A 6: 8,228,120 M679K possibly damaging Het
Mocos T C 18: 24,660,050 F68S probably damaging Het
Nuf2 T C 1: 169,510,549 probably benign Het
Olfr639 A G 7: 104,012,316 Y129H possibly damaging Het
Orc1 T A 4: 108,595,367 D146E probably benign Het
Papd5 C A 8: 88,200,374 Y137* probably null Het
Pcdhb22 T C 18: 37,518,574 F32L probably benign Het
Pde4d G T 13: 109,951,275 E562D possibly damaging Het
Pgk2 T C 17: 40,207,800 K246E probably damaging Het
Plekhh2 A T 17: 84,577,146 probably benign Het
Pou3f2 A T 4: 22,487,162 C324S probably damaging Het
Prkdc C T 16: 15,667,700 L464F possibly damaging Het
Prrc2a T C 17: 35,157,887 H749R possibly damaging Het
Rad18 T C 6: 112,620,902 N218S possibly damaging Het
Rbm11 T C 16: 75,596,643 Y76H possibly damaging Het
Rif1 T G 2: 52,111,555 Y1674D possibly damaging Het
Rrp1b A G 17: 32,056,637 H386R possibly damaging Het
Sacs T C 14: 61,202,761 V752A probably benign Het
Sema3c A G 5: 17,678,336 D314G possibly damaging Het
Spata2l G A 8: 123,233,333 R406C probably damaging Het
Tacc2 C T 7: 130,663,003 probably benign Het
Trpc4 A G 3: 54,195,002 E107G probably damaging Het
Vmn2r70 A G 7: 85,565,054 S297P probably damaging Het
Xdh A G 17: 73,923,078 I286T probably benign Het
Zfp608 T C 18: 54,898,391 T826A probably benign Het
Zfp646 T A 7: 127,883,511 V1620E probably benign Het
Zfyve28 T G 5: 34,232,205 D217A probably damaging Het
Zmym6 G A 4: 127,123,005 G768R probably benign Het
Other mutations in Defb26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02342:Defb26 APN 2 152508201 missense possibly damaging 0.71
IGL03370:Defb26 APN 2 152507982 missense probably benign 0.12
R0078:Defb26 UTSW 2 152508068 missense possibly damaging 0.70
R0306:Defb26 UTSW 2 152507968 missense unknown
R1935:Defb26 UTSW 2 152508275 missense possibly damaging 0.85
R1936:Defb26 UTSW 2 152508275 missense possibly damaging 0.85
R4604:Defb26 UTSW 2 152508184 missense possibly damaging 0.53
R4888:Defb26 UTSW 2 152508165 missense possibly damaging 0.72
R5121:Defb26 UTSW 2 152508165 missense possibly damaging 0.72
R5262:Defb26 UTSW 2 152507958 missense unknown
R5720:Defb26 UTSW 2 152508202 missense possibly damaging 0.71
R6257:Defb26 UTSW 2 152507940 missense unknown
Predicted Primers PCR Primer
(F):5'- CAAAACACCAATACCATTGTTCATCTGAAACT -3'
(R):5'- GTATCATGCTGCATTCACCGAACTCT -3'

Sequencing Primer
(F):5'- CATTGTTCATCTGAAACTAGCCTG -3'
(R):5'- CCCGACTTACTGATAACTGGGATG -3'
Posted On2014-02-11