Incidental Mutation 'R1351:Arhgef26'
ID156639
Institutional Source Beutler Lab
Gene Symbol Arhgef26
Ensembl Gene ENSMUSG00000036885
Gene NameRho guanine nucleotide exchange factor (GEF) 26
Synonyms4631416L12Rik, 8430436L14Rik
MMRRC Submission 039416-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.216) question?
Stock #R1351 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location62338344-62462221 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 62380841 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 444 (E444G)
Ref Sequence ENSEMBL: ENSMUSP00000078281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079300]
Predicted Effect probably damaging
Transcript: ENSMUST00000079300
AA Change: E444G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078281
Gene: ENSMUSG00000036885
AA Change: E444G

DomainStartEndE-ValueType
low complexity region 133 144 N/A INTRINSIC
low complexity region 392 403 N/A INTRINSIC
RhoGEF 441 620 1e-45 SMART
PH 654 782 4.04e-9 SMART
SH3 790 847 3.82e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159746
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161493
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163008
Meta Mutation Damage Score 0.8633 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Rho-guanine nucleotide exchange factor (Rho-GEF) family. These proteins regulate Rho GTPases by catalyzing the exchange of GDP for GTP. The encoded protein specifically activates RhoG and plays a role in the promotion of macropinocytosis. Underexpression of the encoded protein may be a predictive marker of chemoresistant disease. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit defective activation of RhoG and reduced membrane protrusion after ICAM-1 clustering. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Astl G A 2: 127,347,185 V144M possibly damaging Het
AW146154 A T 7: 41,480,454 C413S probably damaging Het
Bicdl2 G A 17: 23,667,545 probably benign Het
Cacna1h G T 17: 25,391,951 S624R probably benign Het
Car9 G T 4: 43,512,439 probably null Het
Cep126 C T 9: 8,100,086 E816K probably damaging Het
Cyp2j13 T C 4: 96,056,918 K291R probably benign Het
Defb26 A T 2: 152,507,817 M181K unknown Het
Dicer1 G A 12: 104,729,142 R177C probably damaging Het
Eif4g2 A G 7: 111,074,080 Y831H probably damaging Het
Ermap C T 4: 119,181,361 probably null Het
Fcamr C T 1: 130,813,020 T392I possibly damaging Het
Fgf3 T C 7: 144,840,780 probably benign Het
Gpr162 T C 6: 124,861,198 Y163C probably damaging Het
Gprc5d T C 6: 135,116,232 R226G possibly damaging Het
Hapln3 A C 7: 79,121,960 S60R probably damaging Het
Hif1a T C 12: 73,940,461 S443P probably benign Het
Irf2bpl A G 12: 86,882,624 M425T probably benign Het
Lrrc39 G T 3: 116,565,820 A5S possibly damaging Het
Mbtps1 A G 8: 119,518,162 L850S possibly damaging Het
Mios T A 6: 8,228,120 M679K possibly damaging Het
Mocos T C 18: 24,660,050 F68S probably damaging Het
Nuf2 T C 1: 169,510,549 probably benign Het
Olfr639 A G 7: 104,012,316 Y129H possibly damaging Het
Orc1 T A 4: 108,595,367 D146E probably benign Het
Papd5 C A 8: 88,200,374 Y137* probably null Het
Pcdhb22 T C 18: 37,518,574 F32L probably benign Het
Pde4d G T 13: 109,951,275 E562D possibly damaging Het
Pgk2 T C 17: 40,207,800 K246E probably damaging Het
Plekhh2 A T 17: 84,577,146 probably benign Het
Pou3f2 A T 4: 22,487,162 C324S probably damaging Het
Prkdc C T 16: 15,667,700 L464F possibly damaging Het
Prrc2a T C 17: 35,157,887 H749R possibly damaging Het
Rad18 T C 6: 112,620,902 N218S possibly damaging Het
Rbm11 T C 16: 75,596,643 Y76H possibly damaging Het
Rif1 T G 2: 52,111,555 Y1674D possibly damaging Het
Rrp1b A G 17: 32,056,637 H386R possibly damaging Het
Sacs T C 14: 61,202,761 V752A probably benign Het
Sema3c A G 5: 17,678,336 D314G possibly damaging Het
Spata2l G A 8: 123,233,333 R406C probably damaging Het
Tacc2 C T 7: 130,663,003 probably benign Het
Trpc4 A G 3: 54,195,002 E107G probably damaging Het
Vmn2r70 A G 7: 85,565,054 S297P probably damaging Het
Xdh A G 17: 73,923,078 I286T probably benign Het
Zfp608 T C 18: 54,898,391 T826A probably benign Het
Zfp646 T A 7: 127,883,511 V1620E probably benign Het
Zfyve28 T G 5: 34,232,205 D217A probably damaging Het
Zmym6 G A 4: 127,123,005 G768R probably benign Het
Other mutations in Arhgef26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Arhgef26 APN 3 62340383 missense probably benign
IGL01060:Arhgef26 APN 3 62340121 missense probably benign 0.44
IGL01942:Arhgef26 APN 3 62340094 missense probably benign 0.03
IGL02085:Arhgef26 APN 3 62459724 intron probably benign
IGL02172:Arhgef26 APN 3 62459676 missense probably benign 0.03
IGL03017:Arhgef26 APN 3 62448281 missense possibly damaging 0.46
IGL03101:Arhgef26 APN 3 62419661 missense possibly damaging 0.95
IGL03296:Arhgef26 APN 3 62423505 missense probably damaging 1.00
IGL03401:Arhgef26 APN 3 62423532 missense possibly damaging 0.95
R0138:Arhgef26 UTSW 3 62448259 missense probably benign 0.06
R0140:Arhgef26 UTSW 3 62448245 missense probably benign 0.02
R0152:Arhgef26 UTSW 3 62423544 missense probably damaging 0.99
R0157:Arhgef26 UTSW 3 62380971 missense probably damaging 1.00
R0308:Arhgef26 UTSW 3 62340399 missense probably benign 0.01
R0317:Arhgef26 UTSW 3 62423544 missense probably damaging 0.99
R0529:Arhgef26 UTSW 3 62339725 missense probably benign
R0825:Arhgef26 UTSW 3 62426593 missense probably damaging 0.97
R1331:Arhgef26 UTSW 3 62340028 missense probably benign 0.00
R1333:Arhgef26 UTSW 3 62340323 missense probably benign 0.04
R1740:Arhgef26 UTSW 3 62423583 missense probably damaging 1.00
R2121:Arhgef26 UTSW 3 62340283 missense probably damaging 0.96
R2404:Arhgef26 UTSW 3 62428915 missense possibly damaging 0.90
R2437:Arhgef26 UTSW 3 62432581 missense probably damaging 0.96
R2939:Arhgef26 UTSW 3 62380910 missense possibly damaging 0.72
R3084:Arhgef26 UTSW 3 62377616 missense probably benign 0.19
R3712:Arhgef26 UTSW 3 62423629 missense probably damaging 1.00
R4005:Arhgef26 UTSW 3 62340395 missense probably benign
R4225:Arhgef26 UTSW 3 62380922 missense probably benign 0.00
R4635:Arhgef26 UTSW 3 62340440 missense probably damaging 1.00
R4961:Arhgef26 UTSW 3 62459625 missense probably damaging 1.00
R4989:Arhgef26 UTSW 3 62340385 missense possibly damaging 0.94
R5249:Arhgef26 UTSW 3 62340560 missense probably damaging 1.00
R5284:Arhgef26 UTSW 3 62419631 missense probably damaging 0.99
R5661:Arhgef26 UTSW 3 62377654 splice site probably benign
R5970:Arhgef26 UTSW 3 62340047 missense probably benign
R6022:Arhgef26 UTSW 3 62428939 missense probably damaging 1.00
R6193:Arhgef26 UTSW 3 62339792 missense possibly damaging 0.49
R6247:Arhgef26 UTSW 3 62380960 missense probably damaging 1.00
R6434:Arhgef26 UTSW 3 62428914 missense probably damaging 0.99
R6827:Arhgef26 UTSW 3 62423498 splice site probably null
R7111:Arhgef26 UTSW 3 62345268 missense possibly damaging 0.90
R7128:Arhgef26 UTSW 3 62419550 missense possibly damaging 0.94
R7360:Arhgef26 UTSW 3 62448205 missense possibly damaging 0.63
R7456:Arhgef26 UTSW 3 62340055 missense probably benign 0.00
R8039:Arhgef26 UTSW 3 62339930 missense probably benign 0.32
R8120:Arhgef26 UTSW 3 62341375 missense probably damaging 1.00
Z1177:Arhgef26 UTSW 3 62339930 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- TACCCTGTGGCAAAGGCATGAC -3'
(R):5'- CTCCCTGCTGAGACAAGTAGCAAG -3'

Sequencing Primer
(F):5'- CTGGTAGAAAGTCATCCTGACTC -3'
(R):5'- TGCTGACTATCTAAATGGGCCAC -3'
Posted On2014-02-11