Incidental Mutation 'R1351:Zfyve28'
ID156648
Institutional Source Beutler Lab
Gene Symbol Zfyve28
Ensembl Gene ENSMUSG00000037224
Gene Namezinc finger, FYVE domain containing 28
Synonyms9630058O20Rik
MMRRC Submission 039416-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1351 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location34194893-34288449 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 34232205 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 217 (D217A)
Ref Sequence ENSEMBL: ENSMUSP00000092464 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094868] [ENSMUST00000114368]
Predicted Effect probably damaging
Transcript: ENSMUST00000094868
AA Change: D217A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000092464
Gene: ENSMUSG00000037224
AA Change: D217A

DomainStartEndE-ValueType
low complexity region 718 730 N/A INTRINSIC
FYVE 827 896 8.73e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114368
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114369
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114370
SMART Domains Protein: ENSMUSP00000110010
Gene: ENSMUSG00000037224

DomainStartEndE-ValueType
coiled coil region 310 344 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130435
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132104
Meta Mutation Damage Score 0.3330 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef26 A G 3: 62,380,841 E444G probably damaging Het
Astl G A 2: 127,347,185 V144M possibly damaging Het
AW146154 A T 7: 41,480,454 C413S probably damaging Het
Bicdl2 G A 17: 23,667,545 probably benign Het
Cacna1h G T 17: 25,391,951 S624R probably benign Het
Car9 G T 4: 43,512,439 probably null Het
Cep126 C T 9: 8,100,086 E816K probably damaging Het
Cyp2j13 T C 4: 96,056,918 K291R probably benign Het
Defb26 A T 2: 152,507,817 M181K unknown Het
Dicer1 G A 12: 104,729,142 R177C probably damaging Het
Eif4g2 A G 7: 111,074,080 Y831H probably damaging Het
Ermap C T 4: 119,181,361 probably null Het
Fcamr C T 1: 130,813,020 T392I possibly damaging Het
Fgf3 T C 7: 144,840,780 probably benign Het
Gpr162 T C 6: 124,861,198 Y163C probably damaging Het
Gprc5d T C 6: 135,116,232 R226G possibly damaging Het
Hapln3 A C 7: 79,121,960 S60R probably damaging Het
Hif1a T C 12: 73,940,461 S443P probably benign Het
Irf2bpl A G 12: 86,882,624 M425T probably benign Het
Lrrc39 G T 3: 116,565,820 A5S possibly damaging Het
Mbtps1 A G 8: 119,518,162 L850S possibly damaging Het
Mios T A 6: 8,228,120 M679K possibly damaging Het
Mocos T C 18: 24,660,050 F68S probably damaging Het
Nuf2 T C 1: 169,510,549 probably benign Het
Olfr639 A G 7: 104,012,316 Y129H possibly damaging Het
Orc1 T A 4: 108,595,367 D146E probably benign Het
Papd5 C A 8: 88,200,374 Y137* probably null Het
Pcdhb22 T C 18: 37,518,574 F32L probably benign Het
Pde4d G T 13: 109,951,275 E562D possibly damaging Het
Pgk2 T C 17: 40,207,800 K246E probably damaging Het
Plekhh2 A T 17: 84,577,146 probably benign Het
Pou3f2 A T 4: 22,487,162 C324S probably damaging Het
Prkdc C T 16: 15,667,700 L464F possibly damaging Het
Prrc2a T C 17: 35,157,887 H749R possibly damaging Het
Rad18 T C 6: 112,620,902 N218S possibly damaging Het
Rbm11 T C 16: 75,596,643 Y76H possibly damaging Het
Rif1 T G 2: 52,111,555 Y1674D possibly damaging Het
Rrp1b A G 17: 32,056,637 H386R possibly damaging Het
Sacs T C 14: 61,202,761 V752A probably benign Het
Sema3c A G 5: 17,678,336 D314G possibly damaging Het
Spata2l G A 8: 123,233,333 R406C probably damaging Het
Tacc2 C T 7: 130,663,003 probably benign Het
Trpc4 A G 3: 54,195,002 E107G probably damaging Het
Vmn2r70 A G 7: 85,565,054 S297P probably damaging Het
Xdh A G 17: 73,923,078 I286T probably benign Het
Zfp608 T C 18: 54,898,391 T826A probably benign Het
Zfp646 T A 7: 127,883,511 V1620E probably benign Het
Zmym6 G A 4: 127,123,005 G768R probably benign Het
Other mutations in Zfyve28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Zfyve28 APN 5 34243195 missense probably damaging 0.98
IGL02201:Zfyve28 APN 5 34243205 missense probably damaging 1.00
PIT4418001:Zfyve28 UTSW 5 34233377 missense probably damaging 1.00
R0499:Zfyve28 UTSW 5 34232206 missense possibly damaging 0.65
R1226:Zfyve28 UTSW 5 34217064 missense probably benign 0.00
R1290:Zfyve28 UTSW 5 34198801 missense probably benign 0.00
R1418:Zfyve28 UTSW 5 34217246 missense probably damaging 0.99
R2062:Zfyve28 UTSW 5 34234337 missense probably null 0.73
R2212:Zfyve28 UTSW 5 34199684 missense probably benign 0.02
R2443:Zfyve28 UTSW 5 34216894 missense possibly damaging 0.64
R2851:Zfyve28 UTSW 5 34196662 missense probably damaging 1.00
R2852:Zfyve28 UTSW 5 34196662 missense probably damaging 1.00
R3412:Zfyve28 UTSW 5 34199684 missense probably benign 0.02
R3413:Zfyve28 UTSW 5 34199684 missense probably benign 0.02
R3694:Zfyve28 UTSW 5 34217468 missense probably damaging 1.00
R4645:Zfyve28 UTSW 5 34222443 intron probably benign
R4700:Zfyve28 UTSW 5 34217845 missense probably damaging 1.00
R4938:Zfyve28 UTSW 5 34233354 missense probably damaging 0.99
R5384:Zfyve28 UTSW 5 34216967 missense probably damaging 1.00
R5908:Zfyve28 UTSW 5 34216870 missense possibly damaging 0.62
R5936:Zfyve28 UTSW 5 34224988 missense probably damaging 1.00
R6260:Zfyve28 UTSW 5 34198872 missense probably damaging 0.99
R6862:Zfyve28 UTSW 5 34288105 missense probably benign 0.10
R7172:Zfyve28 UTSW 5 34234409 missense probably benign 0.42
R7243:Zfyve28 UTSW 5 34198875 missense probably damaging 1.00
R7366:Zfyve28 UTSW 5 34232227 missense probably damaging 1.00
R7598:Zfyve28 UTSW 5 34236117 missense probably damaging 1.00
R7654:Zfyve28 UTSW 5 34243195 missense probably damaging 1.00
R7752:Zfyve28 UTSW 5 34224982 missense probably damaging 1.00
R7861:Zfyve28 UTSW 5 34217143 missense probably damaging 1.00
R7878:Zfyve28 UTSW 5 34199655 missense probably damaging 1.00
R7901:Zfyve28 UTSW 5 34224982 missense probably damaging 1.00
R8116:Zfyve28 UTSW 5 34217600 missense probably damaging 0.96
R8483:Zfyve28 UTSW 5 34236136 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- CAGTCTGCAATATGAGTGCCACCC -3'
(R):5'- TCTTGGCTTCCAGGTTAGGCAAAG -3'

Sequencing Primer
(F):5'- CAGGAAGTTCTCTGAATACTTGGC -3'
(R):5'- CTTCCAGGTTAGGCAAAGTACTG -3'
Posted On2014-02-11