Incidental Mutation 'R1351:Hif1a'
ID156664
Institutional Source Beutler Lab
Gene Symbol Hif1a
Ensembl Gene ENSMUSG00000021109
Gene Namehypoxia inducible factor 1, alpha subunit
SynonymsbHLHe78, HIF1alpha, MOP1, HIF-1alpha
MMRRC Submission 039416-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1351 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location73901375-73947530 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73940461 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 443 (S443P)
Ref Sequence ENSEMBL: ENSMUSP00000106088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021530] [ENSMUST00000110461]
Predicted Effect probably benign
Transcript: ENSMUST00000021530
AA Change: S455P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000021530
Gene: ENSMUSG00000021109
AA Change: S455P

DomainStartEndE-ValueType
HLH 23 78 1.29e-8 SMART
PAS 87 153 1.05e-9 SMART
PAS 230 296 2.08e-8 SMART
PAC 302 345 6.85e-9 SMART
low complexity region 416 427 N/A INTRINSIC
Pfam:HIF-1 564 594 5.4e-18 PFAM
low complexity region 621 645 N/A INTRINSIC
Pfam:HIF-1a_CTAD 799 835 3.9e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110461
AA Change: S443P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000106088
Gene: ENSMUSG00000021109
AA Change: S443P

DomainStartEndE-ValueType
HLH 11 66 1.29e-8 SMART
PAS 75 141 1.05e-9 SMART
PAS 218 284 2.08e-8 SMART
PAC 290 333 6.85e-9 SMART
low complexity region 404 415 N/A INTRINSIC
Pfam:HIF-1 536 569 6e-19 PFAM
low complexity region 595 619 N/A INTRINSIC
Pfam:HIF-1a_CTAD 771 810 1.2e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125308
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157041
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221427
Predicted Effect probably benign
Transcript: ENSMUST00000221833
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: This gene encodes the alpha subunit which, along with the beta subunit, forms a heterodimeric transcription factor that regulates the cellular and developmental response to reduced oxygen tension. The transcription factor has been shown to regulate genes involved in several biological processes, including erythropoiesis and angiogenesis which aid in increased delivery of oxygen to hypoxic regions. The transcription factor also plays a role in the induction of genes involved in cell proliferation and survival, energy metabolism, apoptosis, and glucose and iron metabolism. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mutants die during embryonic development with severe cardiovascular malformations, neural tube defects, cephalic defects, reduced somite number and increased hypoxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef26 A G 3: 62,380,841 E444G probably damaging Het
Astl G A 2: 127,347,185 V144M possibly damaging Het
AW146154 A T 7: 41,480,454 C413S probably damaging Het
Bicdl2 G A 17: 23,667,545 probably benign Het
Cacna1h G T 17: 25,391,951 S624R probably benign Het
Car9 G T 4: 43,512,439 probably null Het
Cep126 C T 9: 8,100,086 E816K probably damaging Het
Cyp2j13 T C 4: 96,056,918 K291R probably benign Het
Defb26 A T 2: 152,507,817 M181K unknown Het
Dicer1 G A 12: 104,729,142 R177C probably damaging Het
Eif4g2 A G 7: 111,074,080 Y831H probably damaging Het
Ermap C T 4: 119,181,361 probably null Het
Fcamr C T 1: 130,813,020 T392I possibly damaging Het
Fgf3 T C 7: 144,840,780 probably benign Het
Gpr162 T C 6: 124,861,198 Y163C probably damaging Het
Gprc5d T C 6: 135,116,232 R226G possibly damaging Het
Hapln3 A C 7: 79,121,960 S60R probably damaging Het
Irf2bpl A G 12: 86,882,624 M425T probably benign Het
Lrrc39 G T 3: 116,565,820 A5S possibly damaging Het
Mbtps1 A G 8: 119,518,162 L850S possibly damaging Het
Mios T A 6: 8,228,120 M679K possibly damaging Het
Mocos T C 18: 24,660,050 F68S probably damaging Het
Nuf2 T C 1: 169,510,549 probably benign Het
Olfr639 A G 7: 104,012,316 Y129H possibly damaging Het
Orc1 T A 4: 108,595,367 D146E probably benign Het
Papd5 C A 8: 88,200,374 Y137* probably null Het
Pcdhb22 T C 18: 37,518,574 F32L probably benign Het
Pde4d G T 13: 109,951,275 E562D possibly damaging Het
Pgk2 T C 17: 40,207,800 K246E probably damaging Het
Plekhh2 A T 17: 84,577,146 probably benign Het
Pou3f2 A T 4: 22,487,162 C324S probably damaging Het
Prkdc C T 16: 15,667,700 L464F possibly damaging Het
Prrc2a T C 17: 35,157,887 H749R possibly damaging Het
Rad18 T C 6: 112,620,902 N218S possibly damaging Het
Rbm11 T C 16: 75,596,643 Y76H possibly damaging Het
Rif1 T G 2: 52,111,555 Y1674D possibly damaging Het
Rrp1b A G 17: 32,056,637 H386R possibly damaging Het
Sacs T C 14: 61,202,761 V752A probably benign Het
Sema3c A G 5: 17,678,336 D314G possibly damaging Het
Spata2l G A 8: 123,233,333 R406C probably damaging Het
Tacc2 C T 7: 130,663,003 probably benign Het
Trpc4 A G 3: 54,195,002 E107G probably damaging Het
Vmn2r70 A G 7: 85,565,054 S297P probably damaging Het
Xdh A G 17: 73,923,078 I286T probably benign Het
Zfp608 T C 18: 54,898,391 T826A probably benign Het
Zfp646 T A 7: 127,883,511 V1620E probably benign Het
Zfyve28 T G 5: 34,232,205 D217A probably damaging Het
Zmym6 G A 4: 127,123,005 G768R probably benign Het
Other mutations in Hif1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Hif1a APN 12 73942010 missense probably damaging 1.00
IGL01396:Hif1a APN 12 73940533 missense probably benign 0.00
IGL02230:Hif1a APN 12 73932450 missense probably damaging 1.00
IGL02561:Hif1a APN 12 73942206 missense possibly damaging 0.52
IGL02698:Hif1a APN 12 73930771 critical splice donor site probably null
IGL03027:Hif1a APN 12 73940477 missense probably benign 0.03
lightweight UTSW 12 73941800 missense probably damaging 1.00
R0597:Hif1a UTSW 12 73942275 missense probably benign 0.00
R0614:Hif1a UTSW 12 73945631 missense probably damaging 1.00
R0678:Hif1a UTSW 12 73944191 splice site probably null
R0967:Hif1a UTSW 12 73937670 missense possibly damaging 0.91
R1387:Hif1a UTSW 12 73942292 missense possibly damaging 0.95
R1858:Hif1a UTSW 12 73944155 missense probably benign
R2105:Hif1a UTSW 12 73937745 missense probably damaging 1.00
R2194:Hif1a UTSW 12 73930747 missense probably damaging 0.98
R4825:Hif1a UTSW 12 73932401 missense probably damaging 1.00
R4924:Hif1a UTSW 12 73939557 missense probably damaging 1.00
R5386:Hif1a UTSW 12 73944093 missense probably benign 0.02
R5594:Hif1a UTSW 12 73937792 nonsense probably null
R5722:Hif1a UTSW 12 73941759 missense probably benign 0.00
R5818:Hif1a UTSW 12 73939564 missense possibly damaging 0.64
R5831:Hif1a UTSW 12 73942144 missense probably benign
R6026:Hif1a UTSW 12 73932281 missense probably damaging 1.00
R6059:Hif1a UTSW 12 73941800 missense probably damaging 1.00
R6084:Hif1a UTSW 12 73941842 missense probably damaging 0.99
R6818:Hif1a UTSW 12 73945563 nonsense probably null
R6878:Hif1a UTSW 12 73928281 missense possibly damaging 0.49
R8028:Hif1a UTSW 12 73942027 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- CACCTCACTGCACCATTCAGTAGAG -3'
(R):5'- AGTGCTTCCATCAGAAGGACTTGC -3'

Sequencing Primer
(F):5'- CTCCTATCAGTGGTGGACTATAACAG -3'
(R):5'- ACTTGCTGGCTGATCTTGAATC -3'
Posted On2014-02-11