Incidental Mutation 'R1351:Rrp1b'
ID156673
Institutional Source Beutler Lab
Gene Symbol Rrp1b
Ensembl Gene ENSMUSG00000058392
Gene Nameribosomal RNA processing 1 homolog B (S. cerevisiae)
Synonyms
MMRRC Submission 039416-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1351 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location32036100-32062865 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32056637 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 386 (H386R)
Ref Sequence ENSEMBL: ENSMUSP00000080085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081339] [ENSMUST00000150469]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081339
AA Change: H386R

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000080085
Gene: ENSMUSG00000058392
AA Change: H386R

DomainStartEndE-ValueType
Pfam:Nop52 10 218 3.3e-73 PFAM
low complexity region 344 352 N/A INTRINSIC
low complexity region 376 384 N/A INTRINSIC
low complexity region 450 463 N/A INTRINSIC
low complexity region 483 496 N/A INTRINSIC
low complexity region 694 706 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126602
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136094
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137917
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147076
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149746
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150151
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150187
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150469
SMART Domains Protein: ENSMUSP00000117400
Gene: ENSMUSG00000058392

DomainStartEndE-ValueType
low complexity region 96 107 N/A INTRINSIC
Meta Mutation Damage Score 0.0624 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef26 A G 3: 62,380,841 E444G probably damaging Het
Astl G A 2: 127,347,185 V144M possibly damaging Het
AW146154 A T 7: 41,480,454 C413S probably damaging Het
Bicdl2 G A 17: 23,667,545 probably benign Het
Cacna1h G T 17: 25,391,951 S624R probably benign Het
Car9 G T 4: 43,512,439 probably null Het
Cep126 C T 9: 8,100,086 E816K probably damaging Het
Cyp2j13 T C 4: 96,056,918 K291R probably benign Het
Defb26 A T 2: 152,507,817 M181K unknown Het
Dicer1 G A 12: 104,729,142 R177C probably damaging Het
Eif4g2 A G 7: 111,074,080 Y831H probably damaging Het
Ermap C T 4: 119,181,361 probably null Het
Fcamr C T 1: 130,813,020 T392I possibly damaging Het
Fgf3 T C 7: 144,840,780 probably benign Het
Gpr162 T C 6: 124,861,198 Y163C probably damaging Het
Gprc5d T C 6: 135,116,232 R226G possibly damaging Het
Hapln3 A C 7: 79,121,960 S60R probably damaging Het
Hif1a T C 12: 73,940,461 S443P probably benign Het
Irf2bpl A G 12: 86,882,624 M425T probably benign Het
Lrrc39 G T 3: 116,565,820 A5S possibly damaging Het
Mbtps1 A G 8: 119,518,162 L850S possibly damaging Het
Mios T A 6: 8,228,120 M679K possibly damaging Het
Mocos T C 18: 24,660,050 F68S probably damaging Het
Nuf2 T C 1: 169,510,549 probably benign Het
Olfr639 A G 7: 104,012,316 Y129H possibly damaging Het
Orc1 T A 4: 108,595,367 D146E probably benign Het
Papd5 C A 8: 88,200,374 Y137* probably null Het
Pcdhb22 T C 18: 37,518,574 F32L probably benign Het
Pde4d G T 13: 109,951,275 E562D possibly damaging Het
Pgk2 T C 17: 40,207,800 K246E probably damaging Het
Plekhh2 A T 17: 84,577,146 probably benign Het
Pou3f2 A T 4: 22,487,162 C324S probably damaging Het
Prkdc C T 16: 15,667,700 L464F possibly damaging Het
Prrc2a T C 17: 35,157,887 H749R possibly damaging Het
Rad18 T C 6: 112,620,902 N218S possibly damaging Het
Rbm11 T C 16: 75,596,643 Y76H possibly damaging Het
Rif1 T G 2: 52,111,555 Y1674D possibly damaging Het
Sacs T C 14: 61,202,761 V752A probably benign Het
Sema3c A G 5: 17,678,336 D314G possibly damaging Het
Spata2l G A 8: 123,233,333 R406C probably damaging Het
Tacc2 C T 7: 130,663,003 probably benign Het
Trpc4 A G 3: 54,195,002 E107G probably damaging Het
Vmn2r70 A G 7: 85,565,054 S297P probably damaging Het
Xdh A G 17: 73,923,078 I286T probably benign Het
Zfp608 T C 18: 54,898,391 T826A probably benign Het
Zfp646 T A 7: 127,883,511 V1620E probably benign Het
Zfyve28 T G 5: 34,232,205 D217A probably damaging Het
Zmym6 G A 4: 127,123,005 G768R probably benign Het
Other mutations in Rrp1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Rrp1b APN 17 32052819 missense probably benign 0.09
IGL01383:Rrp1b APN 17 32058578 missense probably damaging 0.99
IGL02740:Rrp1b APN 17 32059331 missense probably damaging 1.00
IGL03030:Rrp1b APN 17 32056901 missense probably damaging 1.00
IGL03181:Rrp1b APN 17 32057176 missense probably benign 0.13
IGL03396:Rrp1b APN 17 32057263 splice site probably benign
IGL02980:Rrp1b UTSW 17 32050039 missense possibly damaging 0.49
R0138:Rrp1b UTSW 17 32060452 missense probably benign 0.24
R0394:Rrp1b UTSW 17 32058564 missense probably benign 0.34
R0681:Rrp1b UTSW 17 32060395 missense probably damaging 1.00
R1315:Rrp1b UTSW 17 32056639 missense probably benign 0.00
R1700:Rrp1b UTSW 17 32057204 missense probably benign 0.19
R1815:Rrp1b UTSW 17 32056811 missense probably benign
R1940:Rrp1b UTSW 17 32056845 missense possibly damaging 0.95
R2176:Rrp1b UTSW 17 32056560 missense probably benign 0.00
R2352:Rrp1b UTSW 17 32059328 missense possibly damaging 0.71
R2975:Rrp1b UTSW 17 32058573 missense probably damaging 1.00
R4552:Rrp1b UTSW 17 32056010 splice site probably benign
R5114:Rrp1b UTSW 17 32036471 utr 5 prime probably benign
R5242:Rrp1b UTSW 17 32051703 missense possibly damaging 0.82
R5647:Rrp1b UTSW 17 32056011 splice site probably benign
R5739:Rrp1b UTSW 17 32045976 missense probably damaging 1.00
R5853:Rrp1b UTSW 17 32056684 missense possibly damaging 0.49
R5878:Rrp1b UTSW 17 32047675 missense probably damaging 1.00
R6389:Rrp1b UTSW 17 32056627 missense possibly damaging 0.55
R6734:Rrp1b UTSW 17 32055304 intron probably benign
R6742:Rrp1b UTSW 17 32056934 missense probably benign
R6759:Rrp1b UTSW 17 32057089 missense probably benign 0.01
R6855:Rrp1b UTSW 17 32052745 missense probably benign 0.00
R7014:Rrp1b UTSW 17 32049427 missense probably damaging 1.00
R7315:Rrp1b UTSW 17 32058571 missense probably benign 0.03
R7689:Rrp1b UTSW 17 32055926 missense probably benign 0.38
R7834:Rrp1b UTSW 17 32051724 missense probably benign 0.00
R7917:Rrp1b UTSW 17 32051724 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCACAGATCCTCTGGGTTCTGTC -3'
(R):5'- ACATGTCCTCCTGAGGTAAAGTGGTG -3'

Sequencing Primer
(F):5'- ttacctactaagccatctgcc -3'
(R):5'- ATGGGCATGACGGGTGTAG -3'
Posted On2014-02-11