Incidental Mutation 'R1352:Gmppa'
ID156683
Institutional Source Beutler Lab
Gene Symbol Gmppa
Ensembl Gene ENSMUSG00000033021
Gene NameGDP-mannose pyrophosphorylase A
Synonyms
MMRRC Submission 039417-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.231) question?
Stock #R1352 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location75435930-75443179 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 75440534 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 204 (D204E)
Ref Sequence ENSEMBL: ENSMUSP00000122443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037796] [ENSMUST00000113584] [ENSMUST00000131545] [ENSMUST00000133418] [ENSMUST00000140287] [ENSMUST00000141124] [ENSMUST00000143730] [ENSMUST00000144874] [ENSMUST00000145166] [ENSMUST00000188097]
Predicted Effect probably benign
Transcript: ENSMUST00000037796
AA Change: D204E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000035564
Gene: ENSMUSG00000033021
AA Change: D204E

DomainStartEndE-ValueType
Pfam:NTP_transferase 3 209 1.2e-30 PFAM
Pfam:NTP_transf_3 4 206 4.1e-10 PFAM
Pfam:Hexapep 280 321 2.6e-8 PFAM
low complexity region 357 365 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113584
AA Change: D204E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109214
Gene: ENSMUSG00000033021
AA Change: D204E

DomainStartEndE-ValueType
Pfam:NTP_transferase 3 209 1.6e-28 PFAM
Pfam:NTP_transf_3 4 206 1.6e-9 PFAM
Pfam:Hexapep 286 321 4.3e-8 PFAM
low complexity region 357 365 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124539
Predicted Effect probably benign
Transcript: ENSMUST00000131545
AA Change: D204E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000120841
Gene: ENSMUSG00000033021
AA Change: D204E

DomainStartEndE-ValueType
Pfam:NTP_transferase 3 209 7.2e-31 PFAM
Pfam:NTP_transf_3 4 157 1.7e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132291
Predicted Effect probably benign
Transcript: ENSMUST00000133418
AA Change: D204E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000122443
Gene: ENSMUSG00000033021
AA Change: D204E

DomainStartEndE-ValueType
Pfam:NTP_transferase 3 209 6.8e-31 PFAM
Pfam:NTP_transf_3 4 204 1e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135453
Predicted Effect probably benign
Transcript: ENSMUST00000140287
SMART Domains Protein: ENSMUSP00000121552
Gene: ENSMUSG00000033021

DomainStartEndE-ValueType
Pfam:NTP_transferase 3 161 1.7e-22 PFAM
Pfam:NTP_transf_3 4 155 6.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141124
SMART Domains Protein: ENSMUSP00000116783
Gene: ENSMUSG00000033021

DomainStartEndE-ValueType
Pfam:NTP_transferase 3 72 1.1e-13 PFAM
Pfam:NTP_transf_3 4 71 1.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143730
SMART Domains Protein: ENSMUSP00000114375
Gene: ENSMUSG00000033021

DomainStartEndE-ValueType
Pfam:NTP_transferase 3 196 1.1e-30 PFAM
Pfam:NTP_transf_3 4 173 9.2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144874
AA Change: D169E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000121418
Gene: ENSMUSG00000033021
AA Change: D169E

DomainStartEndE-ValueType
Pfam:NTP_transferase 1 174 6.6e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145166
SMART Domains Protein: ENSMUSP00000116754
Gene: ENSMUSG00000033021

DomainStartEndE-ValueType
Pfam:NTP_transferase 3 91 5.2e-15 PFAM
Pfam:NTP_transf_3 4 88 1.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188097
SMART Domains Protein: ENSMUSP00000139936
Gene: ENSMUSG00000033021

DomainStartEndE-ValueType
Pfam:NTP_transferase 1 150 2.3e-15 PFAM
Pfam:NTP_transf_3 2 142 9.8e-7 PFAM
Meta Mutation Damage Score 0.0691 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.5%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is thought to encode a GDP-mannose pyrophosphorylase. This enzyme catalyzes the reaction which converts mannose-1-phosphate and GTP to GDP-mannose which is involved in the production of N-linked oligosaccharides. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 A G 7: 46,135,468 probably benign Het
Acbd3 T A 1: 180,738,530 Y263N probably damaging Het
Aldh4a1 T C 4: 139,635,519 V142A probably benign Het
Car9 G T 4: 43,512,439 probably null Het
Cass4 T C 2: 172,416,495 S138P probably damaging Het
Cbln4 T C 2: 172,037,456 K171E possibly damaging Het
Cd226 A G 18: 89,247,174 Y79C probably damaging Het
Dclre1a T C 19: 56,545,163 D333G probably damaging Het
Dst T A 1: 34,229,248 probably null Het
Eml5 A G 12: 98,831,003 probably benign Het
Evx1 T C 6: 52,317,010 S388P probably damaging Het
Gins1 T A 2: 150,930,848 L177* probably null Het
Gm5422 A C 10: 31,250,735 noncoding transcript Het
Ifna7 A C 4: 88,816,660 T145P possibly damaging Het
Inhbb T C 1: 119,420,695 D131G probably benign Het
Itpr2 T C 6: 146,111,742 K2679E probably damaging Het
Kif20b C A 19: 34,924,635 H4N probably benign Het
Kng1 G T 16: 23,067,694 probably null Het
Lrrfip1 C T 1: 91,115,367 A498V probably benign Het
Myo3a T A 2: 22,323,675 probably null Het
Nkapl T C 13: 21,468,060 R128G unknown Het
Olfr1350 A T 7: 6,570,783 Y264F probably benign Het
Olfr624 T C 7: 103,670,311 H240R probably damaging Het
Prlr T C 15: 10,328,786 V449A probably benign Het
Rbm44 C A 1: 91,153,042 D317E probably damaging Het
Sirt5 T C 13: 43,394,807 S310P probably damaging Het
Spice1 T C 16: 44,386,822 S856P probably damaging Het
Sptan1 T A 2: 30,021,187 probably benign Het
St6gal1 A G 16: 23,321,651 K191E probably damaging Het
Stat6 A T 10: 127,650,811 Q152L probably benign Het
Stk3 T C 15: 35,008,225 D253G probably damaging Het
Tas2r139 C T 6: 42,140,940 A2V probably benign Het
Tfpi2 A G 6: 3,968,281 L15P probably damaging Het
Topbp1 T A 9: 103,347,008 C1445S probably benign Het
Trappc11 A T 8: 47,525,046 H195Q possibly damaging Het
Ttc21a A T 9: 119,954,652 E600V possibly damaging Het
Ttn T C 2: 76,846,697 probably benign Het
Vmn2r88 T C 14: 51,418,550 S740P probably damaging Het
Wrn A C 8: 33,294,916 V476G probably benign Het
Zdbf2 C A 1: 63,303,053 A197E probably damaging Het
Other mutations in Gmppa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01871:Gmppa APN 1 75437017 missense probably damaging 0.98
IGL02418:Gmppa APN 1 75439020 missense probably damaging 1.00
IGL02899:Gmppa APN 1 75441830 splice site probably null
IGL03009:Gmppa APN 1 75439370 missense probably damaging 1.00
PIT4151001:Gmppa UTSW 1 75441824 nonsense probably null
R0708:Gmppa UTSW 1 75442574 missense probably damaging 1.00
R1886:Gmppa UTSW 1 75442508 missense probably damaging 1.00
R2000:Gmppa UTSW 1 75441528 missense probably damaging 1.00
R3053:Gmppa UTSW 1 75441756 missense probably benign 0.04
R4301:Gmppa UTSW 1 75442496 missense possibly damaging 0.77
R5054:Gmppa UTSW 1 75439371 nonsense probably null
R5791:Gmppa UTSW 1 75442255 missense possibly damaging 0.58
R6801:Gmppa UTSW 1 75441747 missense possibly damaging 0.94
R7806:Gmppa UTSW 1 75438937 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGAACTAGCCCATTCGGGCGTTG -3'
(R):5'- TGGGAGGGACAAACCTGACATTAGC -3'

Sequencing Primer
(F):5'- CCTGAGGGTGATGTAGTATGAG -3'
(R):5'- cccgagcaagagtgtgtg -3'
Posted On2014-02-11