Mutagenetix > Incidental Mutations

Incidental Mutation 'R1352:Myo3a'

156688

Institutional Source

Beutler Lab

Gene Symbol

Myo3a

Ensembl Gene

ENSMUSG00000025716

Gene Name

myosin IIIA

Synonyms

9030416P08Rik

MMRRC Submission

039417-MU

Accession Numbers

Genbank: NM_148413; MGI: 2183924

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1352 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

22227503-22618252 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to A at 22323675 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000120573 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044749] [ENSMUST00000044749] [ENSMUST00000153002] [ENSMUST00000153002]

Predicted Effect

probably null
Transcript: ENSMUST00000044749

SMART Domains

Protein: ENSMUSP00000046329
Gene: ENSMUSG00000025716

Domain	Start	End	E-Value	Type
S_TKc	29	295	1.62e-91	SMART
MYSc	340	1061	2.07e-252	SMART
IQ	1061	1083	2.88e1	SMART
IQ	1088	1110	9.48e-3	SMART
low complexity region	1153	1169	N/A	INTRINSIC
low complexity region	1359	1369	N/A	INTRINSIC
low complexity region	1496	1505	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000044749

SMART Domains

Protein: ENSMUSP00000046329
Gene: ENSMUSG00000025716

Domain	Start	End	E-Value	Type
S_TKc	29	295	1.62e-91	SMART
MYSc	340	1061	2.07e-252	SMART
IQ	1061	1083	2.88e1	SMART
IQ	1088	1110	9.48e-3	SMART
low complexity region	1153	1169	N/A	INTRINSIC
low complexity region	1359	1369	N/A	INTRINSIC
low complexity region	1496	1505	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000153002

SMART Domains

Protein: ENSMUSP00000120573
Gene: ENSMUSG00000025716

Domain	Start	End	E-Value	Type
S_TKc	21	287	1.62e-91	SMART
MYSc	332	753	3.06e-35	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000153002

SMART Domains

Protein: ENSMUSP00000120573
Gene: ENSMUSG00000025716

Domain	Start	End	E-Value	Type
S_TKc	21	287	1.62e-91	SMART
MYSc	332	753	3.06e-35	SMART

Meta Mutation Damage Score

0.9494

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 92.5%

Validation Efficiency

95% (42/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the myosin superfamily. Myosins are actin-dependent motor proteins and are categorized into conventional myosins (class II) and unconventional myosins (classes I and III through XV) based on their variable C-terminal cargo-binding domains. Class III myosins, such as this one, have a kinase domain N-terminal to the conserved N-terminal motor domains and are expressed in photoreceptors. The protein encoded by this gene plays an important role in hearing in humans. Three different recessive, loss of function mutations in the encoded protein have been shown to cause nonsyndromic progressive hearing loss. Expression of this gene is highly restricted, with the strongest expression in retina and cochlea. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit impaired hearing and cochlear hair cell degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc8	A	G	7: 46,135,468		probably benign	Het
Acbd3	T	A	1: 180,738,530	Y263N	probably damaging	Het
Aldh4a1	T	C	4: 139,635,519	V142A	probably benign	Het
Car9	G	T	4: 43,512,439		probably null	Het
Cass4	T	C	2: 172,416,495	S138P	probably damaging	Het
Cbln4	T	C	2: 172,037,456	K171E	possibly damaging	Het
Cd226	A	G	18: 89,247,174	Y79C	probably damaging	Het
Dclre1a	T	C	19: 56,545,163	D333G	probably damaging	Het
Dst	T	A	1: 34,229,248		probably null	Het
Eml5	A	G	12: 98,831,003		probably benign	Het
Evx1	T	C	6: 52,317,010	S388P	probably damaging	Het
Gins1	T	A	2: 150,930,848	L177*	probably null	Het
Gm5422	A	C	10: 31,250,735		noncoding transcript	Het
Gmppa	T	A	1: 75,440,534	D204E	probably benign	Het
Ifna7	A	C	4: 88,816,660	T145P	possibly damaging	Het
Inhbb	T	C	1: 119,420,695	D131G	probably benign	Het
Itpr2	T	C	6: 146,111,742	K2679E	probably damaging	Het
Kif20b	C	A	19: 34,924,635	H4N	probably benign	Het
Kng1	G	T	16: 23,067,694		probably null	Het
Lrrfip1	C	T	1: 91,115,367	A498V	probably benign	Het
Nkapl	T	C	13: 21,468,060	R128G	unknown	Het
Olfr1350	A	T	7: 6,570,783	Y264F	probably benign	Het
Olfr624	T	C	7: 103,670,311	H240R	probably damaging	Het
Prlr	T	C	15: 10,328,786	V449A	probably benign	Het
Rbm44	C	A	1: 91,153,042	D317E	probably damaging	Het
Sirt5	T	C	13: 43,394,807	S310P	probably damaging	Het
Spice1	T	C	16: 44,386,822	S856P	probably damaging	Het
Sptan1	T	A	2: 30,021,187		probably benign	Het
St6gal1	A	G	16: 23,321,651	K191E	probably damaging	Het
Stat6	A	T	10: 127,650,811	Q152L	probably benign	Het
Stk3	T	C	15: 35,008,225	D253G	probably damaging	Het
Tas2r139	C	T	6: 42,140,940	A2V	probably benign	Het
Tfpi2	A	G	6: 3,968,281	L15P	probably damaging	Het
Topbp1	T	A	9: 103,347,008	C1445S	probably benign	Het
Trappc11	A	T	8: 47,525,046	H195Q	possibly damaging	Het
Ttc21a	A	T	9: 119,954,652	E600V	possibly damaging	Het
Ttn	T	C	2: 76,846,697		probably benign	Het
Vmn2r88	T	C	14: 51,418,550	S740P	probably damaging	Het
Wrn	A	C	8: 33,294,916	V476G	probably benign	Het
Zdbf2	C	A	1: 63,303,053	A197E	probably damaging	Het

Other mutations in Myo3a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01014:Myo3a	APN	2	22332473	missense	probably benign	0.42
IGL01307:Myo3a	APN	2	22558289	missense	probably damaging	1.00
IGL01413:Myo3a	APN	2	22297600	missense	probably benign	0.25
IGL01655:Myo3a	APN	2	22423326	missense	probably damaging	1.00
IGL01767:Myo3a	APN	2	22423222	missense	probably damaging	0.96
IGL01803:Myo3a	APN	2	22241115	missense	probably damaging	1.00
IGL01969:Myo3a	APN	2	22297688	missense	probably benign	0.03
IGL02043:Myo3a	APN	2	22399965	missense	probably benign	0.01
IGL02124:Myo3a	APN	2	22577526	missense	probably benign	0.01
IGL02174:Myo3a	APN	2	22332393	missense	probably benign	0.04
IGL02649:Myo3a	APN	2	22323607	missense	probably benign
IGL02976:Myo3a	APN	2	22542452	nonsense	probably null
IGL03328:Myo3a	APN	2	22578198	missense	probably benign	0.02
IGL03376:Myo3a	APN	2	22600074	splice site	probably benign
lose	UTSW	2	22558320	nonsense	probably null
snooze	UTSW	2	22282634	missense	probably damaging	0.99
A5278:Myo3a	UTSW	2	22323653	missense	probably benign	0.27
PIT4445001:Myo3a	UTSW	2	22542415	missense	possibly damaging	0.64
R0008:Myo3a	UTSW	2	22579741	missense	probably damaging	0.99
R0099:Myo3a	UTSW	2	22245598	missense	probably benign	0.03
R0103:Myo3a	UTSW	2	22544322	splice site	probably benign
R0103:Myo3a	UTSW	2	22544322	splice site	probably benign
R0212:Myo3a	UTSW	2	22291848	missense	probably damaging	1.00
R0281:Myo3a	UTSW	2	22245598	missense	probably benign	0.03
R0282:Myo3a	UTSW	2	22245598	missense	probably benign	0.03
R0492:Myo3a	UTSW	2	22323636	missense	possibly damaging	0.46
R0498:Myo3a	UTSW	2	22577429	missense	possibly damaging	0.74
R0594:Myo3a	UTSW	2	22544332	splice site	probably benign
R0609:Myo3a	UTSW	2	22333513	missense	probably benign	0.29
R0609:Myo3a	UTSW	2	22396299	missense	possibly damaging	0.95
R0827:Myo3a	UTSW	2	22558215	missense	probably damaging	1.00
R0968:Myo3a	UTSW	2	22558289	missense	probably damaging	1.00
R1157:Myo3a	UTSW	2	22542414	critical splice acceptor site	probably null
R1301:Myo3a	UTSW	2	22267095	splice site	probably benign
R1443:Myo3a	UTSW	2	22282626	missense	probably damaging	0.99
R1465:Myo3a	UTSW	2	22577927	missense	probably benign	0.00
R1465:Myo3a	UTSW	2	22577927	missense	probably benign	0.00
R1517:Myo3a	UTSW	2	22282634	missense	probably damaging	0.99
R1565:Myo3a	UTSW	2	22340280	missense	probably damaging	1.00
R1712:Myo3a	UTSW	2	22564992	missense	probably damaging	1.00
R1722:Myo3a	UTSW	2	22399827	missense	probably benign	0.03
R1822:Myo3a	UTSW	2	22340280	missense	probably damaging	1.00
R1823:Myo3a	UTSW	2	22340280	missense	probably damaging	1.00
R1824:Myo3a	UTSW	2	22396243	missense	probably benign
R1837:Myo3a	UTSW	2	22577592	missense	possibly damaging	0.76
R1867:Myo3a	UTSW	2	22399846	missense	probably benign	0.00
R1917:Myo3a	UTSW	2	22291922	missense	probably damaging	1.00
R1920:Myo3a	UTSW	2	22564996	missense	probably benign	0.02
R1937:Myo3a	UTSW	2	22396315	missense	probably damaging	1.00
R1954:Myo3a	UTSW	2	22241226	missense	probably damaging	1.00
R1988:Myo3a	UTSW	2	22578128	missense	possibly damaging	0.86
R2091:Myo3a	UTSW	2	22333677	missense	probably damaging	0.99
R2115:Myo3a	UTSW	2	22245531	missense	probably damaging	1.00
R2125:Myo3a	UTSW	2	22578174	missense	probably benign	0.42
R2126:Myo3a	UTSW	2	22578174	missense	probably benign	0.42
R2216:Myo3a	UTSW	2	22577771	missense	probably benign	0.00
R2413:Myo3a	UTSW	2	22577912	missense	probably benign	0.00
R2964:Myo3a	UTSW	2	22340256	missense	possibly damaging	0.90
R3196:Myo3a	UTSW	2	22399868	missense	possibly damaging	0.86
R3837:Myo3a	UTSW	2	22565109	splice site	probably benign
R3905:Myo3a	UTSW	2	22558215	missense	probably damaging	1.00
R3926:Myo3a	UTSW	2	22565041	missense	probably damaging	0.99
R4014:Myo3a	UTSW	2	22578170	missense	possibly damaging	0.76
R4015:Myo3a	UTSW	2	22578170	missense	possibly damaging	0.76
R4017:Myo3a	UTSW	2	22578170	missense	possibly damaging	0.76
R4043:Myo3a	UTSW	2	22333539	splice site	probably benign
R4044:Myo3a	UTSW	2	22577700	missense	probably damaging	0.99
R4057:Myo3a	UTSW	2	22266160	missense	probably benign	0.01
R4192:Myo3a	UTSW	2	22407377	missense	probably damaging	1.00
R4282:Myo3a	UTSW	2	22340278	missense	probably benign	0.14
R4321:Myo3a	UTSW	2	22267155	missense	probably damaging	1.00
R4393:Myo3a	UTSW	2	22577854	missense	probably damaging	0.99
R4398:Myo3a	UTSW	2	22577842	missense	probably benign
R4446:Myo3a	UTSW	2	22600137	missense	probably damaging	1.00
R4685:Myo3a	UTSW	2	22407422	missense	probably damaging	1.00
R5032:Myo3a	UTSW	2	22282602	missense	probably damaging	1.00
R5096:Myo3a	UTSW	2	22574242	missense	probably benign	0.16
R5183:Myo3a	UTSW	2	22578158	missense	probably benign	0.05
R5458:Myo3a	UTSW	2	22245550	missense	probably damaging	1.00
R5502:Myo3a	UTSW	2	22558369	missense	probably damaging	1.00
R5522:Myo3a	UTSW	2	22574341	missense	probably damaging	1.00
R6462:Myo3a	UTSW	2	22558411	missense	probably damaging	1.00
R6479:Myo3a	UTSW	2	22577865	missense	probably benign	0.00
R6513:Myo3a	UTSW	2	22407332	missense	probably damaging	1.00
R6520:Myo3a	UTSW	2	22399926	missense	possibly damaging	0.90
R6602:Myo3a	UTSW	2	22577787	missense	probably damaging	0.96
R6671:Myo3a	UTSW	2	22294522	missense	probably damaging	1.00
R6743:Myo3a	UTSW	2	22361664	missense	probably benign	0.24
R6865:Myo3a	UTSW	2	22574301	missense	probably benign	0.00
R6961:Myo3a	UTSW	2	22245558	missense	probably benign	0.00
R7001:Myo3a	UTSW	2	22332377	missense	probably benign	0.04
R7215:Myo3a	UTSW	2	22245567	missense	possibly damaging	0.78
R7301:Myo3a	UTSW	2	22544466	critical splice donor site	probably null
R7318:Myo3a	UTSW	2	22558320	nonsense	probably null
R7447:Myo3a	UTSW	2	22544426	missense	probably benign	0.27
R7456:Myo3a	UTSW	2	22407444	missense	probably benign	0.08
R7528:Myo3a	UTSW	2	22266114	nonsense	probably null
R7731:Myo3a	UTSW	2	22282589	missense	probably damaging	1.00
R7768:Myo3a	UTSW	2	22241143	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GAGCTTTCCAGTCCCCTAAGACCTAA -3'
(R):5'- TGACTACATTTGTGTCCTTCACCGAAC -3'

Sequencing Primer
(F):5'- GTCCCCTAAGACCTAAACCTTC -3'
(R):5'- atggcaactcacaactatctataac -3'

Posted On

2014-02-11