Mutagenetix > Incidental Mutations

Incidental Mutation 'R1352:Sptan1'

156689

Institutional Source

Beutler Lab

Gene Symbol

Sptan1

Ensembl Gene

ENSMUSG00000057738

Gene Name

spectrin alpha, non-erythrocytic 1

Synonyms

alpha-fodrin, Spna2, 2610027H02Rik, Spna-2

MMRRC Submission

039417-MU

Accession Numbers

Ncbi RefSeq: NM_001076554.2, NM_001177667.1, NM_001177668.1; MGI:98386

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1352 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

29965560-30031451 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 30021187 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000121116 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046257] [ENSMUST00000095083] [ENSMUST00000100225] [ENSMUST00000113717] [ENSMUST00000113719] [ENSMUST00000129241]

Predicted Effect

probably benign
Transcript: ENSMUST00000046257

SMART Domains

Protein: ENSMUSP00000047792
Gene: ENSMUSG00000057738

Domain	Start	End	E-Value	Type
SPEC	47	146	2.1e-30	SMART
SPEC	152	252	2.6e-35	SMART
SPEC	258	358	4.93e-36	SMART
SPEC	364	464	1.08e-27	SMART
SPEC	470	570	9.01e-30	SMART
SPEC	576	675	3.52e-32	SMART
SPEC	681	781	2.15e-36	SMART
SPEC	787	887	2.45e-40	SMART
SPEC	893	1068	1.18e-24	SMART
SH3	970	1025	8.24e-18	SMART
SPEC	1074	1210	6.52e-27	SMART
SPEC	1216	1316	1.44e-37	SMART
SPEC	1322	1422	4.43e-29	SMART
SPEC	1428	1528	7.54e-32	SMART
SPEC	1534	1635	9.65e-30	SMART
SPEC	1641	1741	2.32e-32	SMART
SPEC	1747	1847	6.98e-36	SMART
SPEC	1853	1953	1.53e-32	SMART
SPEC	1959	2060	6.23e-24	SMART
SPEC	2074	2174	2.08e-11	SMART
SPEC	2188	2289	1.07e-4	SMART
EFh	2307	2335	5.78e-7	SMART
EFh	2350	2378	3.85e-3	SMART
efhand_Ca_insen	2382	2451	6.74e-32	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000095083

SMART Domains

Protein: ENSMUSP00000092697
Gene: ENSMUSG00000057738

Domain	Start	End	E-Value	Type
SPEC	47	146	2.1e-30	SMART
SPEC	152	252	2.6e-35	SMART
SPEC	258	358	4.93e-36	SMART
SPEC	364	464	1.08e-27	SMART
SPEC	470	570	9.01e-30	SMART
SPEC	576	675	3.52e-32	SMART
SPEC	681	781	2.15e-36	SMART
SPEC	787	887	2.45e-40	SMART
SPEC	893	1088	1.56e-24	SMART
SH3	970	1025	8.24e-18	SMART
SPEC	1094	1230	6.52e-27	SMART
SPEC	1236	1336	1.44e-37	SMART
SPEC	1342	1442	4.43e-29	SMART
SPEC	1448	1548	7.54e-32	SMART
SPEC	1554	1655	9.65e-30	SMART
SPEC	1661	1761	2.32e-32	SMART
SPEC	1767	1867	6.98e-36	SMART
SPEC	1873	1973	1.53e-32	SMART
SPEC	1979	2080	6.23e-24	SMART
SPEC	2094	2194	2.08e-11	SMART
SPEC	2208	2309	1.07e-4	SMART
EFh	2327	2355	5.78e-7	SMART
EFh	2370	2398	3.85e-3	SMART
efhand_Ca_insen	2402	2471	6.74e-32	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000100225

SMART Domains

Protein: ENSMUSP00000097797
Gene: ENSMUSG00000057738

Domain	Start	End	E-Value	Type
SPEC	47	146	2.1e-30	SMART
SPEC	152	252	2.6e-35	SMART
SPEC	258	358	4.93e-36	SMART
SPEC	364	464	1.08e-27	SMART
SPEC	470	570	9.01e-30	SMART
SPEC	576	675	3.52e-32	SMART
SPEC	681	781	2.15e-36	SMART
SPEC	787	887	2.45e-40	SMART
SPEC	893	1088	1.56e-24	SMART
SH3	970	1025	8.24e-18	SMART
SPEC	1094	1230	6.52e-27	SMART
SPEC	1236	1336	1.44e-37	SMART
SPEC	1342	1442	4.43e-29	SMART
SPEC	1448	1548	7.54e-32	SMART
SPEC	1554	1660	2.06e-24	SMART
SPEC	1666	1766	2.32e-32	SMART
SPEC	1772	1872	6.98e-36	SMART
SPEC	1878	1978	1.53e-32	SMART
SPEC	1984	2085	6.23e-24	SMART
SPEC	2099	2199	2.08e-11	SMART
SPEC	2213	2314	1.07e-4	SMART
EFh	2332	2360	5.78e-7	SMART
EFh	2375	2403	3.85e-3	SMART
efhand_Ca_insen	2407	2476	6.74e-32	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000113717

SMART Domains

Protein: ENSMUSP00000109346
Gene: ENSMUSG00000057738

Domain	Start	End	E-Value	Type
SPEC	47	146	2.1e-30	SMART
SPEC	152	252	2.6e-35	SMART
SPEC	258	358	4.93e-36	SMART
SPEC	364	464	1.08e-27	SMART
SPEC	470	570	9.01e-30	SMART
SPEC	576	675	3.52e-32	SMART
SPEC	681	781	2.15e-36	SMART
SPEC	787	887	2.45e-40	SMART
SPEC	893	1068	1.18e-24	SMART
SH3	970	1025	8.24e-18	SMART
SPEC	1074	1210	6.52e-27	SMART
SPEC	1216	1316	1.44e-37	SMART
SPEC	1322	1422	4.43e-29	SMART
SPEC	1428	1528	7.54e-32	SMART
SPEC	1534	1640	2.06e-24	SMART
SPEC	1646	1746	2.32e-32	SMART
SPEC	1752	1852	6.98e-36	SMART
SPEC	1858	1958	1.53e-32	SMART
SPEC	1964	2065	6.23e-24	SMART
SPEC	2079	2179	2.08e-11	SMART
SPEC	2193	2294	1.07e-4	SMART
EFh	2312	2340	5.78e-7	SMART
EFh	2355	2383	3.85e-3	SMART
efhand_Ca_insen	2387	2456	6.74e-32	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000113719

SMART Domains

Protein: ENSMUSP00000109348
Gene: ENSMUSG00000057738

Domain	Start	End	E-Value	Type
SPEC	47	146	2.1e-30	SMART
SPEC	152	252	2.6e-35	SMART
SPEC	258	358	4.93e-36	SMART
SPEC	364	464	1.08e-27	SMART
SPEC	470	570	9.01e-30	SMART
SPEC	576	675	3.52e-32	SMART
SPEC	681	781	2.15e-36	SMART
SPEC	787	887	2.45e-40	SMART
SPEC	893	1068	1.18e-24	SMART
SH3	970	1025	8.24e-18	SMART
SPEC	1074	1210	6.52e-27	SMART
SPEC	1216	1316	1.44e-37	SMART
SPEC	1322	1422	4.43e-29	SMART
SPEC	1428	1528	7.54e-32	SMART
SPEC	1534	1640	2.06e-24	SMART
SPEC	1646	1746	2.32e-32	SMART
SPEC	1752	1852	6.98e-36	SMART
SPEC	1858	1958	1.53e-32	SMART
SPEC	1964	2065	6.23e-24	SMART
SPEC	2079	2179	2.08e-11	SMART
SPEC	2193	2315	3.27e0	SMART
EFh	2333	2361	5.78e-7	SMART
EFh	2376	2404	3.85e-3	SMART
efhand_Ca_insen	2408	2477	6.74e-32	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000129241

SMART Domains

Protein: ENSMUSP00000121116
Gene: ENSMUSG00000057738

Domain	Start	End	E-Value	Type
Pfam:Spectrin	1	65	9.9e-10	PFAM
SPEC	78	178	2.08e-11	SMART
SPEC	192	314	3.27e0	SMART
EFh	332	360	5.78e-7	SMART
EFh	375	403	3.85e-3	SMART
efhand_Ca_insen	407	476	6.74e-32	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149846

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 92.5%

Validation Efficiency

95% (42/44)

MGI Phenotype

Strain: 3714925; 4330132
Lethality: E12-E17
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrins are a family of filamentous cytoskeletal proteins that function as essential scaffold proteins that stabilize the plasma membrane and organize intracellular organelles. Spectrins are composed of alpha and beta dimers that associate to form tetramers linked in a head-to-head arrangement. This gene encodes an alpha spectrin that is specifically expressed in nonerythrocytic cells. The encoded protein has been implicated in other cellular functions including DNA repair and cell cycle regulation. Mutations in this gene are the cause of early infantile epileptic encephalopathy-5. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygous deletion of the exons encoding the CCC region are normal. Mice homozygous for a gene trap allele exhibit embryonic lethality and abnormal nervous system, heart and craniofacial morphology. [provided by MGI curators]

Allele List at MGI

All alleles(76) : Targeted(1) Gene trapped(75)

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc8	A	G	7: 46,135,468		probably benign	Het
Acbd3	T	A	1: 180,738,530	Y263N	probably damaging	Het
Aldh4a1	T	C	4: 139,635,519	V142A	probably benign	Het
Car9	G	T	4: 43,512,439		probably null	Het
Cass4	T	C	2: 172,416,495	S138P	probably damaging	Het
Cbln4	T	C	2: 172,037,456	K171E	possibly damaging	Het
Cd226	A	G	18: 89,247,174	Y79C	probably damaging	Het
Dclre1a	T	C	19: 56,545,163	D333G	probably damaging	Het
Dst	T	A	1: 34,229,248		probably null	Het
Eml5	A	G	12: 98,831,003		probably benign	Het
Evx1	T	C	6: 52,317,010	S388P	probably damaging	Het
Gins1	T	A	2: 150,930,848	L177*	probably null	Het
Gm5422	A	C	10: 31,250,735		noncoding transcript	Het
Gmppa	T	A	1: 75,440,534	D204E	probably benign	Het
Ifna7	A	C	4: 88,816,660	T145P	possibly damaging	Het
Inhbb	T	C	1: 119,420,695	D131G	probably benign	Het
Itpr2	T	C	6: 146,111,742	K2679E	probably damaging	Het
Kif20b	C	A	19: 34,924,635	H4N	probably benign	Het
Kng1	G	T	16: 23,067,694		probably null	Het
Lrrfip1	C	T	1: 91,115,367	A498V	probably benign	Het
Myo3a	T	A	2: 22,323,675		probably null	Het
Nkapl	T	C	13: 21,468,060	R128G	unknown	Het
Olfr1350	A	T	7: 6,570,783	Y264F	probably benign	Het
Olfr624	T	C	7: 103,670,311	H240R	probably damaging	Het
Prlr	T	C	15: 10,328,786	V449A	probably benign	Het
Rbm44	C	A	1: 91,153,042	D317E	probably damaging	Het
Sirt5	T	C	13: 43,394,807	S310P	probably damaging	Het
Spice1	T	C	16: 44,386,822	S856P	probably damaging	Het
St6gal1	A	G	16: 23,321,651	K191E	probably damaging	Het
Stat6	A	T	10: 127,650,811	Q152L	probably benign	Het
Stk3	T	C	15: 35,008,225	D253G	probably damaging	Het
Tas2r139	C	T	6: 42,140,940	A2V	probably benign	Het
Tfpi2	A	G	6: 3,968,281	L15P	probably damaging	Het
Topbp1	T	A	9: 103,347,008	C1445S	probably benign	Het
Trappc11	A	T	8: 47,525,046	H195Q	possibly damaging	Het
Ttc21a	A	T	9: 119,954,652	E600V	possibly damaging	Het
Ttn	T	C	2: 76,846,697		probably benign	Het
Vmn2r88	T	C	14: 51,418,550	S740P	probably damaging	Het
Wrn	A	C	8: 33,294,916	V476G	probably benign	Het
Zdbf2	C	A	1: 63,303,053	A197E	probably damaging	Het

Other mutations in Sptan1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00668:Sptan1	APN	2	29993956	critical splice donor site	probably null
IGL00932:Sptan1	APN	2	30015610	missense	probably damaging	1.00
IGL00945:Sptan1	APN	2	30000071	splice site	probably benign
IGL01070:Sptan1	APN	2	30014173	critical splice donor site	probably null
IGL01625:Sptan1	APN	2	30026114	missense	probably damaging	1.00
IGL01657:Sptan1	APN	2	30018479	missense	probably benign	0.12
IGL01795:Sptan1	APN	2	30018489	missense	probably benign	0.07
IGL01982:Sptan1	APN	2	30019968	missense	probably damaging	1.00
IGL02040:Sptan1	APN	2	30013713	missense	probably benign	0.43
IGL02158:Sptan1	APN	2	30030324	missense	probably damaging	0.97
IGL02370:Sptan1	APN	2	30030740	missense	probably damaging	0.99
IGL02507:Sptan1	APN	2	30016055	missense	probably damaging	1.00
IGL02552:Sptan1	APN	2	30018474	missense	probably damaging	0.99
IGL02690:Sptan1	APN	2	29998183	missense	possibly damaging	0.78
IGL02715:Sptan1	APN	2	29978576	missense	probably benign	0.03
IGL02725:Sptan1	APN	2	29996043	missense	probably damaging	0.99
IGL03033:Sptan1	APN	2	29991033	missense	probably damaging	1.00
IGL03304:Sptan1	APN	2	29986493	missense	probably damaging	1.00
IGL03405:Sptan1	APN	2	30025581	missense	probably damaging	0.99
R0058:Sptan1	UTSW	2	29993696	splice site	probably null
R0058:Sptan1	UTSW	2	29993696	splice site	probably null
R0066:Sptan1	UTSW	2	30003667	splice site	probably benign
R0066:Sptan1	UTSW	2	30003667	splice site	probably benign
R0071:Sptan1	UTSW	2	30003342	nonsense	probably null
R0071:Sptan1	UTSW	2	30003342	nonsense	probably null
R0094:Sptan1	UTSW	2	30006623	missense	probably benign	0.37
R0230:Sptan1	UTSW	2	30010692	splice site	probably benign
R0242:Sptan1	UTSW	2	30018401	missense	probably benign	0.00
R0242:Sptan1	UTSW	2	30018401	missense	probably benign	0.00
R0366:Sptan1	UTSW	2	29992752	splice site	probably null
R0368:Sptan1	UTSW	2	29993915	missense	probably benign	0.29
R0396:Sptan1	UTSW	2	29991033	missense	probably damaging	1.00
R0423:Sptan1	UTSW	2	30028672	missense	probably null
R0448:Sptan1	UTSW	2	30026810	missense	probably damaging	1.00
R0485:Sptan1	UTSW	2	30013848	splice site	probably benign
R0580:Sptan1	UTSW	2	30007575	missense	probably damaging	0.99
R0739:Sptan1	UTSW	2	30013518	missense	probably damaging	1.00
R0924:Sptan1	UTSW	2	30016028	missense	probably damaging	0.98
R0930:Sptan1	UTSW	2	30016028	missense	probably damaging	0.98
R0961:Sptan1	UTSW	2	29980063	splice site	probably null
R1456:Sptan1	UTSW	2	29980203	critical splice donor site	probably null
R1537:Sptan1	UTSW	2	30026022	missense	possibly damaging	0.95
R1542:Sptan1	UTSW	2	30027127	missense	probably damaging	1.00
R1612:Sptan1	UTSW	2	30003336	missense	probably damaging	1.00
R1623:Sptan1	UTSW	2	29986420	missense	probably damaging	0.96
R1834:Sptan1	UTSW	2	29992001	splice site	probably benign
R1879:Sptan1	UTSW	2	29995528	missense	probably damaging	1.00
R1893:Sptan1	UTSW	2	30020460	missense	probably damaging	0.98
R1914:Sptan1	UTSW	2	30011036	missense	probably benign	0.00
R1915:Sptan1	UTSW	2	30011036	missense	probably benign	0.00
R2022:Sptan1	UTSW	2	30007561	missense	probably damaging	0.96
R2050:Sptan1	UTSW	2	30002238	missense	probably benign
R2103:Sptan1	UTSW	2	30030471	missense	probably damaging	1.00
R2162:Sptan1	UTSW	2	30018576	splice site	probably benign
R2931:Sptan1	UTSW	2	30018488	missense	probably benign
R3726:Sptan1	UTSW	2	30018419	missense	possibly damaging	0.59
R4170:Sptan1	UTSW	2	30030025	missense	possibly damaging	0.93
R4235:Sptan1	UTSW	2	30026588	missense	probably damaging	1.00
R4378:Sptan1	UTSW	2	30025569	missense	probably damaging	1.00
R4424:Sptan1	UTSW	2	30029709	intron	probably benign
R4718:Sptan1	UTSW	2	30031062	missense	probably damaging	1.00
R4777:Sptan1	UTSW	2	29996435	missense	probably damaging	0.98
R4849:Sptan1	UTSW	2	30011042	missense	probably damaging	1.00
R5158:Sptan1	UTSW	2	29978443	missense	probably damaging	1.00
R5180:Sptan1	UTSW	2	29993724	intron	probably benign
R5181:Sptan1	UTSW	2	29993724	intron	probably benign
R5383:Sptan1	UTSW	2	30011328	missense	probably damaging	1.00
R5573:Sptan1	UTSW	2	29986492	nonsense	probably null
R5592:Sptan1	UTSW	2	29986719	intron	probably benign
R5639:Sptan1	UTSW	2	29990993	nonsense	probably null
R5801:Sptan1	UTSW	2	30030601	splice site	probably null
R5947:Sptan1	UTSW	2	29994367	critical splice donor site	probably null
R6056:Sptan1	UTSW	2	29996782	missense	probably benign	0.36
R6090:Sptan1	UTSW	2	29993887	missense	probably damaging	1.00
R6146:Sptan1	UTSW	2	30004523	missense	probably benign	0.01
R6254:Sptan1	UTSW	2	30007549	missense	possibly damaging	0.93
R6366:Sptan1	UTSW	2	30020455	missense	possibly damaging	0.47
R6378:Sptan1	UTSW	2	30018515	missense	probably damaging	1.00
R6521:Sptan1	UTSW	2	30020455	missense	possibly damaging	0.47
R6877:Sptan1	UTSW	2	30030973	missense	probably damaging	0.99
R7173:Sptan1	UTSW	2	29983209	missense	probably benign	0.02
R7248:Sptan1	UTSW	2	30002299	missense	probably benign	0.10
R7282:Sptan1	UTSW	2	29986929	missense	probably damaging	1.00
R7527:Sptan1	UTSW	2	29980197	missense	probably damaging	1.00
R7585:Sptan1	UTSW	2	30000056	missense	probably benign	0.06
R7779:Sptan1	UTSW	2	30021307	missense	probably damaging	1.00
R8051:Sptan1	UTSW	2	30030159	missense	probably damaging	1.00
R8055:Sptan1	UTSW	2	29994339	missense	probably benign	0.22
R8103:Sptan1	UTSW	2	30020043	missense	probably damaging	1.00
R8283:Sptan1	UTSW	2	29980200	missense	probably damaging	1.00
R8507:Sptan1	UTSW	2	30026584	missense	probably damaging	1.00
X0028:Sptan1	UTSW	2	30020030	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTGTCCTATGAGCCTGAACCCAAC -3'
(R):5'- CTTTCCTGACCTGGATAGCAGCAAG -3'

Sequencing Primer
(F):5'- agcactgactgctcttattcc -3'
(R):5'- AGCAAGAGTGTCTCCATAGTC -3'

Posted On

2014-02-11