Mutagenetix > Incidental Mutations

Incidental Mutation 'R1352:Gins1'

156691

Institutional Source

Beutler Lab

Gene Symbol

Gins1

Ensembl Gene

ENSMUSG00000027454

Gene Name

GINS complex subunit 1 (Psf1 homolog)

Synonyms

Psf1, 2810418N01Rik

MMRRC Submission

039417-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1352 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

150905400-150931280 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 150930848 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Stop codon at position 177 (L177*)

Ref Sequence

ENSEMBL: ENSMUSP00000028948 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028948] [ENSMUST00000109896]

Predicted Effect

probably null
Transcript: ENSMUST00000028948
AA Change: L177*

SMART Domains

Protein: ENSMUSP00000028948
Gene: ENSMUSG00000027454
AA Change: L177*

Domain	Start	End	E-Value	Type
PDB:2Q9Q\|G	1	196	1e-141	PDB
Blast:KISc	112	188	3e-17	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000109896

SMART Domains

Protein: ENSMUSP00000105522
Gene: ENSMUSG00000068115

Domain	Start	End	E-Value	Type
EFh	12	40	6.56e0	SMART
low complexity region	76	93	N/A	INTRINSIC
EFh	201	229	4.45e1	SMART
EFh	238	266	8.98e-4	SMART
low complexity region	295	306	N/A	INTRINSIC
coiled coil region	381	423	N/A	INTRINSIC
coiled coil region	461	517	N/A	INTRINSIC
coiled coil region	541	584	N/A	INTRINSIC
coiled coil region	620	699	N/A	INTRINSIC
coiled coil region	728	751	N/A	INTRINSIC
coiled coil region	835	863	N/A	INTRINSIC
coiled coil region	1058	1334	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000121686

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123217

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140950

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152991

Meta Mutation Damage Score

0.9712

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 92.5%

Validation Efficiency

95% (42/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The yeast heterotetrameric GINS complex is made up of Sld5 (GINS4; MIM 610611), Psf1, Psf2 (GINS2; MIM 610609), and Psf3 (GINS3; MIM 610610). The formation of the GINS complex is essential for the initiation of DNA replication in yeast and Xenopus egg extracts (Ueno et al., 2005 [PubMed 16287864]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Embryos homozygous for a knock-out allele display disorganized embryonic and extraembryonic structures and fail to develop past E5.5; mutant blastocysts fail to exhibit outgrowth in culture and show a cell proliferation defect and inner cell mass apoptosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc8	A	G	7: 46,135,468		probably benign	Het
Acbd3	T	A	1: 180,738,530	Y263N	probably damaging	Het
Aldh4a1	T	C	4: 139,635,519	V142A	probably benign	Het
Car9	G	T	4: 43,512,439		probably null	Het
Cass4	T	C	2: 172,416,495	S138P	probably damaging	Het
Cbln4	T	C	2: 172,037,456	K171E	possibly damaging	Het
Cd226	A	G	18: 89,247,174	Y79C	probably damaging	Het
Dclre1a	T	C	19: 56,545,163	D333G	probably damaging	Het
Dst	T	A	1: 34,229,248		probably null	Het
Eml5	A	G	12: 98,831,003		probably benign	Het
Evx1	T	C	6: 52,317,010	S388P	probably damaging	Het
Gm5422	A	C	10: 31,250,735		noncoding transcript	Het
Gmppa	T	A	1: 75,440,534	D204E	probably benign	Het
Ifna7	A	C	4: 88,816,660	T145P	possibly damaging	Het
Inhbb	T	C	1: 119,420,695	D131G	probably benign	Het
Itpr2	T	C	6: 146,111,742	K2679E	probably damaging	Het
Kif20b	C	A	19: 34,924,635	H4N	probably benign	Het
Kng1	G	T	16: 23,067,694		probably null	Het
Lrrfip1	C	T	1: 91,115,367	A498V	probably benign	Het
Myo3a	T	A	2: 22,323,675		probably null	Het
Nkapl	T	C	13: 21,468,060	R128G	unknown	Het
Olfr1350	A	T	7: 6,570,783	Y264F	probably benign	Het
Olfr624	T	C	7: 103,670,311	H240R	probably damaging	Het
Prlr	T	C	15: 10,328,786	V449A	probably benign	Het
Rbm44	C	A	1: 91,153,042	D317E	probably damaging	Het
Sirt5	T	C	13: 43,394,807	S310P	probably damaging	Het
Spice1	T	C	16: 44,386,822	S856P	probably damaging	Het
Sptan1	T	A	2: 30,021,187		probably benign	Het
St6gal1	A	G	16: 23,321,651	K191E	probably damaging	Het
Stat6	A	T	10: 127,650,811	Q152L	probably benign	Het
Stk3	T	C	15: 35,008,225	D253G	probably damaging	Het
Tas2r139	C	T	6: 42,140,940	A2V	probably benign	Het
Tfpi2	A	G	6: 3,968,281	L15P	probably damaging	Het
Topbp1	T	A	9: 103,347,008	C1445S	probably benign	Het
Trappc11	A	T	8: 47,525,046	H195Q	possibly damaging	Het
Ttc21a	A	T	9: 119,954,652	E600V	possibly damaging	Het
Ttn	T	C	2: 76,846,697		probably benign	Het
Vmn2r88	T	C	14: 51,418,550	S740P	probably damaging	Het
Wrn	A	C	8: 33,294,916	V476G	probably benign	Het
Zdbf2	C	A	1: 63,303,053	A197E	probably damaging	Het

Other mutations in Gins1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R1575:Gins1	UTSW	2	150912838	missense	probably benign
R4361:Gins1	UTSW	2	150925901	missense	probably damaging	1.00
R4362:Gins1	UTSW	2	150909762	missense	probably damaging	1.00
R4618:Gins1	UTSW	2	150917861	splice site	probably null
R5769:Gins1	UTSW	2	150925998	missense	probably damaging	0.99
R6642:Gins1	UTSW	2	150928118	critical splice donor site	probably null
R6700:Gins1	UTSW	2	150916228	missense	probably damaging	1.00
R7038:Gins1	UTSW	2	150917871	missense	probably damaging	1.00
R7072:Gins1	UTSW	2	150909751	splice site	probably null
R7325:Gins1	UTSW	2	150916166	missense	probably benign
R8458:Gins1	UTSW	2	150930887	missense	probably benign	0.32

Predicted Primers

PCR Primer
(F):5'- GGAACTGCCAAATGTGTCGCTG -3'
(R):5'- TGTCTGTCAATTTAAAACCAAGGAGGGG -3'

Sequencing Primer
(F):5'- atctacccgcctctgcc -3'
(R):5'- GGAGGTCCAGTGAGGACG -3'

Posted On

2014-02-11