Incidental Mutation 'R1352:Tas2r139'
ID156698
Institutional Source Beutler Lab
Gene Symbol Tas2r139
Ensembl Gene ENSMUSG00000047102
Gene Nametaste receptor, type 2, member 139
Synonymsmt2r34, Tas2r39
MMRRC Submission 039417-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1352 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location42140936-42141895 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 42140940 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 2 (A2V)
Ref Sequence ENSEMBL: ENSMUSP00000062919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057686]
Predicted Effect probably benign
Transcript: ENSMUST00000057686
AA Change: A2V

PolyPhen 2 Score 0.281 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000062919
Gene: ENSMUSG00000047102
AA Change: A2V

DomainStartEndE-ValueType
Pfam:TAS2R 13 311 2.5e-64 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.5%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a bitter taste receptor that detects green tea catechins, soy isoflavones, and theaflavins. The encoded protein is gustducin-linked and may activate alpha gustducin. This gene is intronless. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 A G 7: 46,135,468 probably benign Het
Acbd3 T A 1: 180,738,530 Y263N probably damaging Het
Aldh4a1 T C 4: 139,635,519 V142A probably benign Het
Car9 G T 4: 43,512,439 probably null Het
Cass4 T C 2: 172,416,495 S138P probably damaging Het
Cbln4 T C 2: 172,037,456 K171E possibly damaging Het
Cd226 A G 18: 89,247,174 Y79C probably damaging Het
Dclre1a T C 19: 56,545,163 D333G probably damaging Het
Dst T A 1: 34,229,248 probably null Het
Eml5 A G 12: 98,831,003 probably benign Het
Evx1 T C 6: 52,317,010 S388P probably damaging Het
Gins1 T A 2: 150,930,848 L177* probably null Het
Gm5422 A C 10: 31,250,735 noncoding transcript Het
Gmppa T A 1: 75,440,534 D204E probably benign Het
Ifna7 A C 4: 88,816,660 T145P possibly damaging Het
Inhbb T C 1: 119,420,695 D131G probably benign Het
Itpr2 T C 6: 146,111,742 K2679E probably damaging Het
Kif20b C A 19: 34,924,635 H4N probably benign Het
Kng1 G T 16: 23,067,694 probably null Het
Lrrfip1 C T 1: 91,115,367 A498V probably benign Het
Myo3a T A 2: 22,323,675 probably null Het
Nkapl T C 13: 21,468,060 R128G unknown Het
Olfr1350 A T 7: 6,570,783 Y264F probably benign Het
Olfr624 T C 7: 103,670,311 H240R probably damaging Het
Prlr T C 15: 10,328,786 V449A probably benign Het
Rbm44 C A 1: 91,153,042 D317E probably damaging Het
Sirt5 T C 13: 43,394,807 S310P probably damaging Het
Spice1 T C 16: 44,386,822 S856P probably damaging Het
Sptan1 T A 2: 30,021,187 probably benign Het
St6gal1 A G 16: 23,321,651 K191E probably damaging Het
Stat6 A T 10: 127,650,811 Q152L probably benign Het
Stk3 T C 15: 35,008,225 D253G probably damaging Het
Tfpi2 A G 6: 3,968,281 L15P probably damaging Het
Topbp1 T A 9: 103,347,008 C1445S probably benign Het
Trappc11 A T 8: 47,525,046 H195Q possibly damaging Het
Ttc21a A T 9: 119,954,652 E600V possibly damaging Het
Ttn T C 2: 76,846,697 probably benign Het
Vmn2r88 T C 14: 51,418,550 S740P probably damaging Het
Wrn A C 8: 33,294,916 V476G probably benign Het
Zdbf2 C A 1: 63,303,053 A197E probably damaging Het
Other mutations in Tas2r139
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Tas2r139 APN 6 42141121 missense probably damaging 1.00
IGL01593:Tas2r139 APN 6 42140957 missense probably benign 0.01
IGL01835:Tas2r139 APN 6 42141432 missense probably benign 0.21
IGL02990:Tas2r139 APN 6 42141104 missense probably damaging 1.00
R0517:Tas2r139 UTSW 6 42141491 missense probably damaging 0.98
R1106:Tas2r139 UTSW 6 42141545 missense probably benign 0.36
R4352:Tas2r139 UTSW 6 42141755 missense probably damaging 1.00
R4632:Tas2r139 UTSW 6 42141498 missense probably damaging 1.00
R4785:Tas2r139 UTSW 6 42141284 missense probably damaging 1.00
R4947:Tas2r139 UTSW 6 42141566 missense possibly damaging 0.82
R5888:Tas2r139 UTSW 6 42141496 missense probably damaging 1.00
R6796:Tas2r139 UTSW 6 42141592 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCCATACAGGTGCTTTCCTGG -3'
(R):5'- TGCTGAAGAACATGCTGGAGCTG -3'

Sequencing Primer
(F):5'- TGGATTTCTGGTCCACAGTAAC -3'
(R):5'- GGCCTATTCTGGATACACTCAGAAG -3'
Posted On2014-02-11