Incidental Mutation 'R1352:Olfr624'
ID156703
Institutional Source Beutler Lab
Gene Symbol Olfr624
Ensembl Gene ENSMUSG00000045780
Gene Nameolfactory receptor 624
SynonymsMOR4-2P, GA_x6K02T2PBJ9-6394126-6393197
MMRRC Submission 039417-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R1352 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location103665461-103671191 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103670311 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 240 (H240R)
Ref Sequence ENSEMBL: ENSMUSP00000049938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062144]
Predicted Effect probably damaging
Transcript: ENSMUST00000062144
AA Change: H240R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049938
Gene: ENSMUSG00000045780
AA Change: H240R

DomainStartEndE-ValueType
Pfam:7tm_4 27 306 3.3e-138 PFAM
Pfam:7tm_1 37 288 1.8e-19 PFAM
Meta Mutation Damage Score 0.4742 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.5%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 A G 7: 46,135,468 probably benign Het
Acbd3 T A 1: 180,738,530 Y263N probably damaging Het
Aldh4a1 T C 4: 139,635,519 V142A probably benign Het
Car9 G T 4: 43,512,439 probably null Het
Cass4 T C 2: 172,416,495 S138P probably damaging Het
Cbln4 T C 2: 172,037,456 K171E possibly damaging Het
Cd226 A G 18: 89,247,174 Y79C probably damaging Het
Dclre1a T C 19: 56,545,163 D333G probably damaging Het
Dst T A 1: 34,229,248 probably null Het
Eml5 A G 12: 98,831,003 probably benign Het
Evx1 T C 6: 52,317,010 S388P probably damaging Het
Gins1 T A 2: 150,930,848 L177* probably null Het
Gm5422 A C 10: 31,250,735 noncoding transcript Het
Gmppa T A 1: 75,440,534 D204E probably benign Het
Ifna7 A C 4: 88,816,660 T145P possibly damaging Het
Inhbb T C 1: 119,420,695 D131G probably benign Het
Itpr2 T C 6: 146,111,742 K2679E probably damaging Het
Kif20b C A 19: 34,924,635 H4N probably benign Het
Kng1 G T 16: 23,067,694 probably null Het
Lrrfip1 C T 1: 91,115,367 A498V probably benign Het
Myo3a T A 2: 22,323,675 probably null Het
Nkapl T C 13: 21,468,060 R128G unknown Het
Olfr1350 A T 7: 6,570,783 Y264F probably benign Het
Prlr T C 15: 10,328,786 V449A probably benign Het
Rbm44 C A 1: 91,153,042 D317E probably damaging Het
Sirt5 T C 13: 43,394,807 S310P probably damaging Het
Spice1 T C 16: 44,386,822 S856P probably damaging Het
Sptan1 T A 2: 30,021,187 probably benign Het
St6gal1 A G 16: 23,321,651 K191E probably damaging Het
Stat6 A T 10: 127,650,811 Q152L probably benign Het
Stk3 T C 15: 35,008,225 D253G probably damaging Het
Tas2r139 C T 6: 42,140,940 A2V probably benign Het
Tfpi2 A G 6: 3,968,281 L15P probably damaging Het
Topbp1 T A 9: 103,347,008 C1445S probably benign Het
Trappc11 A T 8: 47,525,046 H195Q possibly damaging Het
Ttc21a A T 9: 119,954,652 E600V possibly damaging Het
Ttn T C 2: 76,846,697 probably benign Het
Vmn2r88 T C 14: 51,418,550 S740P probably damaging Het
Wrn A C 8: 33,294,916 V476G probably benign Het
Zdbf2 C A 1: 63,303,053 A197E probably damaging Het
Other mutations in Olfr624
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02419:Olfr624 APN 7 103670475 nonsense probably null
IGL02536:Olfr624 APN 7 103670957 missense possibly damaging 0.78
IGL02684:Olfr624 APN 7 103670384 missense probably benign 0.06
FR4548:Olfr624 UTSW 7 103670960 small insertion probably benign
FR4548:Olfr624 UTSW 7 103670967 nonsense probably null
FR4976:Olfr624 UTSW 7 103670966 small insertion probably benign
R0295:Olfr624 UTSW 7 103670311 missense probably damaging 1.00
R0518:Olfr624 UTSW 7 103670489 missense possibly damaging 0.56
R0521:Olfr624 UTSW 7 103670489 missense possibly damaging 0.56
R1779:Olfr624 UTSW 7 103670638 missense probably benign 0.15
R1878:Olfr624 UTSW 7 103670182 missense probably damaging 1.00
R1965:Olfr624 UTSW 7 103670896 missense probably damaging 1.00
R2162:Olfr624 UTSW 7 103670872 missense possibly damaging 0.95
R2316:Olfr624 UTSW 7 103670467 missense probably damaging 0.97
R3792:Olfr624 UTSW 7 103670146 missense probably damaging 1.00
R3848:Olfr624 UTSW 7 103670701 missense probably damaging 0.99
R4120:Olfr624 UTSW 7 103671014 missense probably benign
R4183:Olfr624 UTSW 7 103670971 missense possibly damaging 0.87
R4853:Olfr624 UTSW 7 103670803 missense probably damaging 1.00
R6351:Olfr624 UTSW 7 103670956 missense possibly damaging 0.50
R7717:Olfr624 UTSW 7 103670945 missense probably benign
RF005:Olfr624 UTSW 7 103670785 frame shift probably null
X0026:Olfr624 UTSW 7 103670395 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTTTGCAGTCCTCTTCTGAGAGTGC -3'
(R):5'- ACAGAATCCTGAAAATCGGAGTGGC -3'

Sequencing Primer
(F):5'- GGACCTGAGGACTTAGATTCCATTC -3'
(R):5'- CTGCACCAAGACTTGATTCG -3'
Posted On2014-02-11