Mutagenetix > Incidental Mutation

Incidental Mutation 'R1352:Trappc11'

156705

Institutional Source

Beutler Lab

Gene Symbol

Trappc11

Ensembl Gene

ENSMUSG00000038102

Gene Name

trafficking protein particle complex 11

Synonyms

D030016E14Rik

MMRRC Submission

039417-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1352 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

47490115-47533470 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 47525046 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 195 (H195Q)

Ref Sequence

ENSEMBL: ENSMUSP00000047562 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039061]

AlphaFold

B2RXC1

Predicted Effect

possibly damaging
Transcript: ENSMUST00000039061
AA Change: H195Q

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000047562
Gene: ENSMUSG00000038102
AA Change: H195Q

Domain	Start	End	E-Value	Type
Pfam:Foie-gras_1	263	522	3e-78	PFAM
Pfam:Gryzun	978	1114	3.9e-10	PFAM
Pfam:Gryzun-like	1036	1095	2.4e-28	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123958

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125065

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131551

Meta Mutation Damage Score

0.1887

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 92.5%

Validation Efficiency

95% (42/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the TRAPP (transport protein particle) tethering complex, which functions in intracellular vesicle trafficking. This subunit is involved in early stage endoplasmic reticulum-to-Golgi vesicle transport. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2013]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc8	A	G	7: 46,135,468		probably benign	Het
Acbd3	T	A	1: 180,738,530	Y263N	probably damaging	Het
Aldh4a1	T	C	4: 139,635,519	V142A	probably benign	Het
Car9	G	T	4: 43,512,439		probably null	Het
Cass4	T	C	2: 172,416,495	S138P	probably damaging	Het
Cbln4	T	C	2: 172,037,456	K171E	possibly damaging	Het
Cd226	A	G	18: 89,247,174	Y79C	probably damaging	Het
Dclre1a	T	C	19: 56,545,163	D333G	probably damaging	Het
Dst	T	A	1: 34,229,248		probably null	Het
Eml5	A	G	12: 98,831,003		probably benign	Het
Evx1	T	C	6: 52,317,010	S388P	probably damaging	Het
Gins1	T	A	2: 150,930,848	L177*	probably null	Het
Gm5422	A	C	10: 31,250,735		noncoding transcript	Het
Gmppa	T	A	1: 75,440,534	D204E	probably benign	Het
Ifna7	A	C	4: 88,816,660	T145P	possibly damaging	Het
Inhbb	T	C	1: 119,420,695	D131G	probably benign	Het
Itpr2	T	C	6: 146,111,742	K2679E	probably damaging	Het
Kif20b	C	A	19: 34,924,635	H4N	probably benign	Het
Kng1	G	T	16: 23,067,694		probably null	Het
Lrrfip1	C	T	1: 91,115,367	A498V	probably benign	Het
Myo3a	T	A	2: 22,323,675		probably null	Het
Nkapl	T	C	13: 21,468,060	R128G	unknown	Het
Olfr1350	A	T	7: 6,570,783	Y264F	probably benign	Het
Olfr624	T	C	7: 103,670,311	H240R	probably damaging	Het
Prlr	T	C	15: 10,328,786	V449A	probably benign	Het
Rbm44	C	A	1: 91,153,042	D317E	probably damaging	Het
Sirt5	T	C	13: 43,394,807	S310P	probably damaging	Het
Spice1	T	C	16: 44,386,822	S856P	probably damaging	Het
Sptan1	T	A	2: 30,021,187		probably benign	Het
St6gal1	A	G	16: 23,321,651	K191E	probably damaging	Het
Stat6	A	T	10: 127,650,811	Q152L	probably benign	Het
Stk3	T	C	15: 35,008,225	D253G	probably damaging	Het
Tas2r139	C	T	6: 42,140,940	A2V	probably benign	Het
Tfpi2	A	G	6: 3,968,281	L15P	probably damaging	Het
Topbp1	T	A	9: 103,347,008	C1445S	probably benign	Het
Ttc21a	A	T	9: 119,954,652	E600V	possibly damaging	Het
Ttn	T	C	2: 76,846,697		probably benign	Het
Vmn2r88	T	C	14: 51,418,550	S740P	probably damaging	Het
Wrn	A	C	8: 33,294,916	V476G	probably benign	Het
Zdbf2	C	A	1: 63,303,053	A197E	probably damaging	Het

Other mutations in Trappc11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00324:Trappc11	APN	8	47503302	unclassified	probably benign
IGL01300:Trappc11	APN	8	47501868	missense	probably benign
IGL01312:Trappc11	APN	8	47505677	missense	possibly damaging	0.95
IGL01344:Trappc11	APN	8	47519704	missense	probably damaging	1.00
IGL01518:Trappc11	APN	8	47501869	splice site	probably null
IGL01747:Trappc11	APN	8	47519621	missense	probably benign	0.41
IGL01781:Trappc11	APN	8	47514128	missense	possibly damaging	0.95
IGL01908:Trappc11	APN	8	47503994	missense	probably damaging	1.00
IGL01956:Trappc11	APN	8	47528001	missense	possibly damaging	0.86
IGL02266:Trappc11	APN	8	47505731	missense	probably damaging	1.00
IGL02377:Trappc11	APN	8	47530650	critical splice donor site	probably null
IGL02530:Trappc11	APN	8	47507582	missense	probably damaging	1.00
IGL02676:Trappc11	APN	8	47493413	splice site	probably benign
IGL03030:Trappc11	APN	8	47513929	missense	probably damaging	0.98
IGL03393:Trappc11	APN	8	47510877	missense	possibly damaging	0.95
bantu	UTSW	8	47498666	missense	probably benign	0.44
bunyoro	UTSW	8	47512285	splice site	probably null
nyoro	UTSW	8	47526979	missense	possibly damaging	0.73
serval	UTSW	8	47503965	missense	probably damaging	1.00
R0009:Trappc11	UTSW	8	47503320	missense	possibly damaging	0.70
R0009:Trappc11	UTSW	8	47503320	missense	possibly damaging	0.70
R0043:Trappc11	UTSW	8	47505575	splice site	probably benign
R0180:Trappc11	UTSW	8	47527974	missense	possibly damaging	0.86
R0529:Trappc11	UTSW	8	47526979	missense	possibly damaging	0.73
R0538:Trappc11	UTSW	8	47503412	missense	probably benign	0.01
R0740:Trappc11	UTSW	8	47524588	missense	probably damaging	0.99
R1469:Trappc11	UTSW	8	47503965	missense	probably damaging	1.00
R1469:Trappc11	UTSW	8	47503965	missense	probably damaging	1.00
R1502:Trappc11	UTSW	8	47530827	missense	possibly damaging	0.94
R1589:Trappc11	UTSW	8	47501680	missense	probably damaging	1.00
R1741:Trappc11	UTSW	8	47529327	critical splice donor site	probably null
R2292:Trappc11	UTSW	8	47505736	missense	probably damaging	1.00
R2303:Trappc11	UTSW	8	47503416	missense	probably damaging	0.99
R2931:Trappc11	UTSW	8	47503942	missense	probably damaging	0.99
R3522:Trappc11	UTSW	8	47498673	missense	possibly damaging	0.93
R3714:Trappc11	UTSW	8	47505316	intron	probably benign
R3739:Trappc11	UTSW	8	47514103	missense	probably damaging	0.98
R4165:Trappc11	UTSW	8	47524968	splice site	probably benign
R4581:Trappc11	UTSW	8	47493345	missense	probably damaging	0.97
R4598:Trappc11	UTSW	8	47513766	missense	probably damaging	0.98
R4939:Trappc11	UTSW	8	47519665	missense	probably damaging	1.00
R4990:Trappc11	UTSW	8	47490895	missense	probably benign	0.41
R4994:Trappc11	UTSW	8	47522441	nonsense	probably null
R5091:Trappc11	UTSW	8	47512604	missense	probably benign	0.00
R5123:Trappc11	UTSW	8	47513402	missense	probably damaging	0.99
R5176:Trappc11	UTSW	8	47510963	missense	possibly damaging	0.79
R5279:Trappc11	UTSW	8	47505304	intron	probably benign
R5293:Trappc11	UTSW	8	47493342	missense	possibly damaging	0.83
R5294:Trappc11	UTSW	8	47530731	missense	possibly damaging	0.88
R5661:Trappc11	UTSW	8	47512607	missense	probably damaging	0.99
R5838:Trappc11	UTSW	8	47512559	critical splice donor site	probably null
R5889:Trappc11	UTSW	8	47519578	missense	probably benign	0.40
R5952:Trappc11	UTSW	8	47496917	critical splice donor site	probably null
R5959:Trappc11	UTSW	8	47501558	missense	probably damaging	0.97
R6239:Trappc11	UTSW	8	47529494	missense	possibly damaging	0.73
R6322:Trappc11	UTSW	8	47530773	missense	possibly damaging	0.95
R6369:Trappc11	UTSW	8	47512285	splice site	probably null
R7541:Trappc11	UTSW	8	47505582	splice site	probably null
R7544:Trappc11	UTSW	8	47522414	missense	possibly damaging	0.73
R7762:Trappc11	UTSW	8	47522376	missense	probably damaging	0.99
R7964:Trappc11	UTSW	8	47526944	missense	possibly damaging	0.54
R8183:Trappc11	UTSW	8	47529356	missense	possibly damaging	0.93
R8282:Trappc11	UTSW	8	47516589	missense	probably damaging	0.97
R8733:Trappc11	UTSW	8	47501848	missense	probably damaging	1.00
R8782:Trappc11	UTSW	8	47498666	missense	probably benign	0.44
R8853:Trappc11	UTSW	8	47529404	missense	probably damaging	0.98
R9544:Trappc11	UTSW	8	47519678	missense	possibly damaging	0.94
R9709:Trappc11	UTSW	8	47493313	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TGAAAACAGAAACTTACTTCAGGGCGT -3'
(R):5'- AAAGCCAGCGAGATCGCCTAATTTAT -3'

Sequencing Primer
(F):5'- CTGATGTCTAACAAACAAAAGCTG -3'
(R):5'- AAATCTGGAATATCCTGTGTTGTAAG -3'

Posted On

2014-02-11