Incidental Mutation 'R1352:Vmn2r88'
ID 156714
Institutional Source Beutler Lab
Gene Symbol Vmn2r88
Ensembl Gene ENSMUSG00000000606
Gene Name vomeronasal 2, receptor 88
Synonyms V2r13, V2r3
MMRRC Submission 039417-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.154) question?
Stock # R1352 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 51648458-51656984 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 51656007 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 740 (S740P)
Ref Sequence ENSEMBL: ENSMUSP00000154310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022438] [ENSMUST00000159674] [ENSMUST00000162998] [ENSMUST00000228139]
AlphaFold L7N1W8
Predicted Effect probably damaging
Transcript: ENSMUST00000022438
AA Change: S748P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022438
Gene: ENSMUSG00000000606
AA Change: S748P

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ANF_receptor 76 457 8.3e-27 PFAM
Pfam:NCD3G 516 570 1.2e-18 PFAM
Pfam:7tm_3 603 838 1.9e-55 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159674
AA Change: S739P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125126
Gene: ENSMUSG00000000606
AA Change: S739P

DomainStartEndE-ValueType
Pfam:ANF_receptor 30 408 3.2e-30 PFAM
Pfam:NCD3G 463 516 1.2e-19 PFAM
Pfam:7tm_3 546 785 3.7e-81 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161565
Predicted Effect probably benign
Transcript: ENSMUST00000162998
SMART Domains Protein: ENSMUSP00000125409
Gene: ENSMUSG00000068399

DomainStartEndE-ValueType
Pfam:Takusan 35 115 2.2e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163019
SMART Domains Protein: ENSMUSP00000124837
Gene: ENSMUSG00000000606

DomainStartEndE-ValueType
Pfam:ANF_receptor 52 399 3.7e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000228139
AA Change: S740P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.5%
Validation Efficiency 95% (42/44)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 A G 7: 45,784,892 (GRCm39) probably benign Het
Acbd3 T A 1: 180,566,095 (GRCm39) Y263N probably damaging Het
Aldh4a1 T C 4: 139,362,830 (GRCm39) V142A probably benign Het
Car9 G T 4: 43,512,439 (GRCm39) probably null Het
Cass4 T C 2: 172,258,415 (GRCm39) S138P probably damaging Het
Cbln4 T C 2: 171,879,376 (GRCm39) K171E possibly damaging Het
Cd226 A G 18: 89,265,298 (GRCm39) Y79C probably damaging Het
Dclre1a T C 19: 56,533,595 (GRCm39) D333G probably damaging Het
Dst T A 1: 34,268,329 (GRCm39) probably null Het
Eml5 A G 12: 98,797,262 (GRCm39) probably benign Het
Evx1 T C 6: 52,293,995 (GRCm39) S388P probably damaging Het
Gins1 T A 2: 150,772,768 (GRCm39) L177* probably null Het
Gm5422 A C 10: 31,126,731 (GRCm39) noncoding transcript Het
Gmppa T A 1: 75,417,178 (GRCm39) D204E probably benign Het
Ifna7 A C 4: 88,734,897 (GRCm39) T145P possibly damaging Het
Inhbb T C 1: 119,348,425 (GRCm39) D131G probably benign Het
Itpr2 T C 6: 146,013,240 (GRCm39) K2679E probably damaging Het
Kif20b C A 19: 34,902,035 (GRCm39) H4N probably benign Het
Kng1 G T 16: 22,886,444 (GRCm39) probably null Het
Lrrfip1 C T 1: 91,043,089 (GRCm39) A498V probably benign Het
Myo3a T A 2: 22,328,486 (GRCm39) probably null Het
Nkapl T C 13: 21,652,230 (GRCm39) R128G unknown Het
Or51v8 T C 7: 103,319,518 (GRCm39) H240R probably damaging Het
Or5bw2 A T 7: 6,573,782 (GRCm39) Y264F probably benign Het
Prlr T C 15: 10,328,872 (GRCm39) V449A probably benign Het
Rbm44 C A 1: 91,080,764 (GRCm39) D317E probably damaging Het
Sirt5 T C 13: 43,548,283 (GRCm39) S310P probably damaging Het
Spice1 T C 16: 44,207,185 (GRCm39) S856P probably damaging Het
Sptan1 T A 2: 29,911,199 (GRCm39) probably benign Het
St6gal1 A G 16: 23,140,401 (GRCm39) K191E probably damaging Het
Stat6 A T 10: 127,486,680 (GRCm39) Q152L probably benign Het
Stk3 T C 15: 35,008,371 (GRCm39) D253G probably damaging Het
Tas2r139 C T 6: 42,117,874 (GRCm39) A2V probably benign Het
Tfpi2 A G 6: 3,968,281 (GRCm39) L15P probably damaging Het
Topbp1 T A 9: 103,224,207 (GRCm39) C1445S probably benign Het
Trappc11 A T 8: 47,978,081 (GRCm39) H195Q possibly damaging Het
Ttc21a A T 9: 119,783,718 (GRCm39) E600V possibly damaging Het
Ttn T C 2: 76,677,041 (GRCm39) probably benign Het
Wrn A C 8: 33,784,944 (GRCm39) V476G probably benign Het
Zdbf2 C A 1: 63,342,212 (GRCm39) A197E probably damaging Het
Other mutations in Vmn2r88
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Vmn2r88 APN 14 51,650,713 (GRCm39) missense probably benign 0.00
IGL00990:Vmn2r88 APN 14 51,650,517 (GRCm39) missense probably benign 0.00
IGL00990:Vmn2r88 APN 14 51,650,582 (GRCm39) missense probably benign 0.00
IGL00990:Vmn2r88 APN 14 51,654,259 (GRCm39) missense possibly damaging 0.59
IGL02308:Vmn2r88 APN 14 51,655,437 (GRCm39) missense possibly damaging 0.96
IGL02481:Vmn2r88 APN 14 51,651,611 (GRCm39) missense probably benign
IGL02483:Vmn2r88 APN 14 51,651,611 (GRCm39) missense probably benign
IGL03241:Vmn2r88 APN 14 51,655,830 (GRCm39) missense probably benign 0.03
R0052:Vmn2r88 UTSW 14 51,656,157 (GRCm39) missense possibly damaging 0.88
R0070:Vmn2r88 UTSW 14 51,651,597 (GRCm39) missense probably benign 0.08
R0799:Vmn2r88 UTSW 14 51,651,959 (GRCm39) missense possibly damaging 0.61
R0906:Vmn2r88 UTSW 14 51,655,666 (GRCm39) missense probably damaging 1.00
R1322:Vmn2r88 UTSW 14 51,651,565 (GRCm39) missense probably damaging 1.00
R1639:Vmn2r88 UTSW 14 51,654,244 (GRCm39) missense probably damaging 0.98
R1780:Vmn2r88 UTSW 14 51,656,029 (GRCm39) missense probably damaging 1.00
R1834:Vmn2r88 UTSW 14 51,650,487 (GRCm39) splice site probably benign
R1911:Vmn2r88 UTSW 14 51,655,671 (GRCm39) missense probably damaging 1.00
R2113:Vmn2r88 UTSW 14 51,655,651 (GRCm39) missense probably damaging 1.00
R2120:Vmn2r88 UTSW 14 51,650,665 (GRCm39) missense probably benign 0.00
R2126:Vmn2r88 UTSW 14 51,651,264 (GRCm39) missense probably benign 0.01
R2348:Vmn2r88 UTSW 14 51,651,461 (GRCm39) missense probably benign 0.00
R2881:Vmn2r88 UTSW 14 51,656,146 (GRCm39) missense probably damaging 0.97
R2884:Vmn2r88 UTSW 14 51,651,391 (GRCm39) missense probably damaging 1.00
R3081:Vmn2r88 UTSW 14 51,656,089 (GRCm39) missense probably damaging 0.99
R3933:Vmn2r88 UTSW 14 51,651,435 (GRCm39) missense probably benign 0.44
R3967:Vmn2r88 UTSW 14 51,650,647 (GRCm39) missense probably benign 0.06
R4091:Vmn2r88 UTSW 14 51,652,883 (GRCm39) missense probably damaging 1.00
R4378:Vmn2r88 UTSW 14 51,650,746 (GRCm39) nonsense probably null
R4397:Vmn2r88 UTSW 14 51,655,435 (GRCm39) missense probably damaging 1.00
R4418:Vmn2r88 UTSW 14 51,655,538 (GRCm39) missense probably damaging 1.00
R4609:Vmn2r88 UTSW 14 51,655,531 (GRCm39) missense probably damaging 0.98
R4647:Vmn2r88 UTSW 14 51,656,250 (GRCm39) missense probably benign 0.02
R4672:Vmn2r88 UTSW 14 51,655,612 (GRCm39) missense probably damaging 1.00
R4684:Vmn2r88 UTSW 14 51,650,791 (GRCm39) missense possibly damaging 0.95
R4686:Vmn2r88 UTSW 14 51,650,796 (GRCm39) missense probably benign 0.03
R4720:Vmn2r88 UTSW 14 51,650,702 (GRCm39) missense probably benign 0.01
R5046:Vmn2r88 UTSW 14 51,650,638 (GRCm39) missense probably benign 0.03
R5063:Vmn2r88 UTSW 14 51,648,603 (GRCm39) missense probably damaging 0.96
R5619:Vmn2r88 UTSW 14 51,651,367 (GRCm39) missense probably damaging 0.99
R5652:Vmn2r88 UTSW 14 51,656,029 (GRCm39) missense probably damaging 0.98
R6020:Vmn2r88 UTSW 14 51,655,606 (GRCm39) nonsense probably null
R6103:Vmn2r88 UTSW 14 51,652,826 (GRCm39) missense probably benign 0.17
R6674:Vmn2r88 UTSW 14 51,651,795 (GRCm39) missense probably benign 0.01
R6799:Vmn2r88 UTSW 14 51,651,426 (GRCm39) missense probably benign 0.05
R7089:Vmn2r88 UTSW 14 51,656,100 (GRCm39) missense
R7104:Vmn2r88 UTSW 14 51,651,253 (GRCm39) missense
R7265:Vmn2r88 UTSW 14 51,655,776 (GRCm39) missense
R7316:Vmn2r88 UTSW 14 51,651,712 (GRCm39) missense
R7552:Vmn2r88 UTSW 14 51,648,315 (GRCm39) splice site probably null
R7611:Vmn2r88 UTSW 14 51,651,454 (GRCm39) missense
R7667:Vmn2r88 UTSW 14 51,655,446 (GRCm39) missense
R7682:Vmn2r88 UTSW 14 51,655,906 (GRCm39) missense
R7755:Vmn2r88 UTSW 14 51,650,503 (GRCm39) missense probably benign 0.00
R7811:Vmn2r88 UTSW 14 51,656,160 (GRCm39) missense
R7882:Vmn2r88 UTSW 14 51,650,503 (GRCm39) missense probably benign 0.00
R7957:Vmn2r88 UTSW 14 51,650,589 (GRCm39) missense
R7998:Vmn2r88 UTSW 14 51,651,565 (GRCm39) missense
R8142:Vmn2r88 UTSW 14 51,651,564 (GRCm39) missense
R8186:Vmn2r88 UTSW 14 51,656,157 (GRCm39) missense
R8348:Vmn2r88 UTSW 14 51,656,253 (GRCm39) missense probably damaging 0.97
R8448:Vmn2r88 UTSW 14 51,656,253 (GRCm39) missense probably damaging 0.97
R8483:Vmn2r88 UTSW 14 51,650,530 (GRCm39) missense possibly damaging 0.48
R8783:Vmn2r88 UTSW 14 51,651,523 (GRCm39) missense
R8859:Vmn2r88 UTSW 14 51,656,263 (GRCm39) missense probably damaging 0.97
R8916:Vmn2r88 UTSW 14 51,648,593 (GRCm39) missense
R8936:Vmn2r88 UTSW 14 51,655,983 (GRCm39) missense possibly damaging 0.88
R9004:Vmn2r88 UTSW 14 51,650,624 (GRCm39) missense
R9038:Vmn2r88 UTSW 14 51,651,490 (GRCm39) missense
R9063:Vmn2r88 UTSW 14 51,648,329 (GRCm39) start gained probably benign
R9311:Vmn2r88 UTSW 14 51,650,503 (GRCm39) missense probably benign 0.00
R9382:Vmn2r88 UTSW 14 51,656,197 (GRCm39) missense
R9483:Vmn2r88 UTSW 14 51,648,641 (GRCm39) missense
R9602:Vmn2r88 UTSW 14 51,651,189 (GRCm39) missense
V5622:Vmn2r88 UTSW 14 51,650,584 (GRCm39) missense probably benign
X0024:Vmn2r88 UTSW 14 51,651,289 (GRCm39) missense possibly damaging 0.79
X0025:Vmn2r88 UTSW 14 51,654,259 (GRCm39) missense possibly damaging 0.59
Z1177:Vmn2r88 UTSW 14 51,655,644 (GRCm39) missense
Z1177:Vmn2r88 UTSW 14 51,655,503 (GRCm39) frame shift probably null
Z1190:Vmn2r88 UTSW 14 51,650,658 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- TCTTGCAGCAGACCACATTTGGAG -3'
(R):5'- CCCTGCACTAGAAGCCAAGATTGAG -3'

Sequencing Primer
(F):5'- TTTCAAGCTCACTACTCCAGGAAG -3'
(R):5'- TAGAAGCCAAGATTGAGAAAACCTC -3'
Posted On 2014-02-11