Incidental Mutation 'R1352:Prlr'
ID156715
Institutional Source Beutler Lab
Gene Symbol Prlr
Ensembl Gene ENSMUSG00000005268
Gene Nameprolactin receptor
SynonymsPrlr-rs1, Pr-1
MMRRC Submission 039417-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.260) question?
Stock #R1352 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location10177238-10349180 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 10328786 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 449 (V449A)
Ref Sequence ENSEMBL: ENSMUSP00000122219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124470] [ENSMUST00000128450] [ENSMUST00000128921] [ENSMUST00000137867] [ENSMUST00000148257]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000005400
Predicted Effect probably benign
Transcript: ENSMUST00000124470
AA Change: V449A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122219
Gene: ENSMUSG00000005268
AA Change: V449A

DomainStartEndE-ValueType
FN3 23 107 3.78e0 SMART
FN3 122 210 2.5e-2 SMART
transmembrane domain 231 253 N/A INTRINSIC
low complexity region 278 291 N/A INTRINSIC
low complexity region 342 356 N/A INTRINSIC
low complexity region 384 397 N/A INTRINSIC
low complexity region 454 467 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128450
SMART Domains Protein: ENSMUSP00000122209
Gene: ENSMUSG00000005268

DomainStartEndE-ValueType
FN3 23 107 3.78e0 SMART
FN3 122 210 2.5e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128921
SMART Domains Protein: ENSMUSP00000121280
Gene: ENSMUSG00000005268

DomainStartEndE-ValueType
FN3 23 107 3.78e0 SMART
FN3 122 210 2.5e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137867
SMART Domains Protein: ENSMUSP00000121935
Gene: ENSMUSG00000005268

DomainStartEndE-ValueType
FN3 23 107 3.78e0 SMART
FN3 122 210 2.5e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145428
Predicted Effect probably benign
Transcript: ENSMUST00000148257
SMART Domains Protein: ENSMUSP00000118355
Gene: ENSMUSG00000005268

DomainStartEndE-ValueType
FN3 23 107 3.78e0 SMART
FN3 122 210 2.5e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000157020
SMART Domains Protein: ENSMUSP00000120297
Gene: ENSMUSG00000094814

DomainStartEndE-ValueType
transmembrane domain 20 41 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.5%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for the anterior pituitary hormone, prolactin, and belongs to the type I cytokine receptor family. Prolactin-dependent signaling occurs as the result of ligand-induced dimerization of the prolactin receptor. Several alternatively spliced transcript variants encoding different membrane-bound and soluble isoforms have been described for this gene, which may function to modulate the endocrine and autocrine effects of prolactin in normal tissue and cancer. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal growth, hormone and glucose homeostasis, hair cycling, female reproductive behavior, morphology, and function, and thyroid, prostate, Hardarian, and lacrimal gland morphologies. Heterozygous mice exhibit defective neuron proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 A G 7: 46,135,468 probably benign Het
Acbd3 T A 1: 180,738,530 Y263N probably damaging Het
Aldh4a1 T C 4: 139,635,519 V142A probably benign Het
Car9 G T 4: 43,512,439 probably null Het
Cass4 T C 2: 172,416,495 S138P probably damaging Het
Cbln4 T C 2: 172,037,456 K171E possibly damaging Het
Cd226 A G 18: 89,247,174 Y79C probably damaging Het
Dclre1a T C 19: 56,545,163 D333G probably damaging Het
Dst T A 1: 34,229,248 probably null Het
Eml5 A G 12: 98,831,003 probably benign Het
Evx1 T C 6: 52,317,010 S388P probably damaging Het
Gins1 T A 2: 150,930,848 L177* probably null Het
Gm5422 A C 10: 31,250,735 noncoding transcript Het
Gmppa T A 1: 75,440,534 D204E probably benign Het
Ifna7 A C 4: 88,816,660 T145P possibly damaging Het
Inhbb T C 1: 119,420,695 D131G probably benign Het
Itpr2 T C 6: 146,111,742 K2679E probably damaging Het
Kif20b C A 19: 34,924,635 H4N probably benign Het
Kng1 G T 16: 23,067,694 probably null Het
Lrrfip1 C T 1: 91,115,367 A498V probably benign Het
Myo3a T A 2: 22,323,675 probably null Het
Nkapl T C 13: 21,468,060 R128G unknown Het
Olfr1350 A T 7: 6,570,783 Y264F probably benign Het
Olfr624 T C 7: 103,670,311 H240R probably damaging Het
Rbm44 C A 1: 91,153,042 D317E probably damaging Het
Sirt5 T C 13: 43,394,807 S310P probably damaging Het
Spice1 T C 16: 44,386,822 S856P probably damaging Het
Sptan1 T A 2: 30,021,187 probably benign Het
St6gal1 A G 16: 23,321,651 K191E probably damaging Het
Stat6 A T 10: 127,650,811 Q152L probably benign Het
Stk3 T C 15: 35,008,225 D253G probably damaging Het
Tas2r139 C T 6: 42,140,940 A2V probably benign Het
Tfpi2 A G 6: 3,968,281 L15P probably damaging Het
Topbp1 T A 9: 103,347,008 C1445S probably benign Het
Trappc11 A T 8: 47,525,046 H195Q possibly damaging Het
Ttc21a A T 9: 119,954,652 E600V possibly damaging Het
Ttn T C 2: 76,846,697 probably benign Het
Vmn2r88 T C 14: 51,418,550 S740P probably damaging Het
Wrn A C 8: 33,294,916 V476G probably benign Het
Zdbf2 C A 1: 63,303,053 A197E probably damaging Het
Other mutations in Prlr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Prlr APN 15 10328324 missense probably benign 0.00
IGL00688:Prlr APN 15 10322381 unclassified probably benign
IGL01527:Prlr APN 15 10329171 missense probably benign 0.28
IGL01626:Prlr APN 15 10328718 missense probably benign 0.12
IGL01660:Prlr APN 15 10317590 missense probably damaging 1.00
IGL01835:Prlr APN 15 10329043 missense probably damaging 1.00
IGL01926:Prlr APN 15 10314220 start codon destroyed probably null 0.76
IGL01952:Prlr APN 15 10328342 missense possibly damaging 0.95
IGL02306:Prlr APN 15 10328674 missense probably benign 0.05
IGL02394:Prlr APN 15 10328578 missense probably benign 0.03
IGL02430:Prlr APN 15 10325391 missense probably damaging 1.00
IGL02695:Prlr APN 15 10328365 missense probably benign 0.20
IGL02745:Prlr APN 15 10328594 missense possibly damaging 0.50
IGL03193:Prlr APN 15 10328290 missense possibly damaging 0.57
IGL03277:Prlr APN 15 10328801 missense probably benign 0.01
IGL03379:Prlr APN 15 10319317 missense possibly damaging 0.80
PIT4434001:Prlr UTSW 15 10328372 missense probably damaging 1.00
R0057:Prlr UTSW 15 10328423 missense probably damaging 0.99
R0057:Prlr UTSW 15 10328423 missense probably damaging 0.99
R0545:Prlr UTSW 15 10317566 missense probably damaging 1.00
R1236:Prlr UTSW 15 10325281 missense probably benign 0.13
R1524:Prlr UTSW 15 10319333 missense probably damaging 0.97
R1537:Prlr UTSW 15 10328278 splice site probably null
R1690:Prlr UTSW 15 10317590 missense probably damaging 1.00
R1773:Prlr UTSW 15 10325318 nonsense probably null
R1789:Prlr UTSW 15 10322536 missense probably benign 0.32
R2421:Prlr UTSW 15 10319257 missense probably damaging 1.00
R4518:Prlr UTSW 15 10328999 missense possibly damaging 0.53
R4621:Prlr UTSW 15 10319376 intron probably benign
R4855:Prlr UTSW 15 10328797 missense probably benign 0.01
R4957:Prlr UTSW 15 10319195 missense probably damaging 1.00
R5053:Prlr UTSW 15 10325385 missense probably benign 0.00
R5731:Prlr UTSW 15 10314135 missense probably benign 0.00
R5749:Prlr UTSW 15 10328718 missense probably benign 0.12
R5806:Prlr UTSW 15 10319204 missense probably damaging 1.00
R5927:Prlr UTSW 15 10322446 missense probably benign 0.42
R6170:Prlr UTSW 15 10328849 missense probably benign 0.05
R6911:Prlr UTSW 15 10329184 missense probably benign
R6935:Prlr UTSW 15 10319302 missense probably damaging 1.00
R7327:Prlr UTSW 15 10346438 missense probably benign 0.00
R7539:Prlr UTSW 15 10329023 missense probably benign 0.11
R7579:Prlr UTSW 15 10328935 missense probably benign 0.08
R7615:Prlr UTSW 15 10325924 missense probably damaging 1.00
R7651:Prlr UTSW 15 10328378 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- TGTCTGAAAAGTGTGAGGAGCCCC -3'
(R):5'- CCAGGATGTTGTTATCCGTGACCC -3'

Sequencing Primer
(F):5'- GAGAATCCTGAGGCAAATATTCC -3'
(R):5'- GGAGTAATGATAGCACTCCGTC -3'
Posted On2014-02-11