Incidental Mutation 'R1352:Stk3'
ID156716
Institutional Source Beutler Lab
Gene Symbol Stk3
Ensembl Gene ENSMUSG00000022329
Gene Nameserine/threonine kinase 3
Synonymsmess1, MST, Mst2
MMRRC Submission 039417-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1352 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location34875496-35178921 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35008225 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 253 (D253G)
Ref Sequence ENSEMBL: ENSMUSP00000018476 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018476] [ENSMUST00000067033] [ENSMUST00000226555]
Predicted Effect probably damaging
Transcript: ENSMUST00000018476
AA Change: D253G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000018476
Gene: ENSMUSG00000022329
AA Change: D253G

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
S_TKc 27 278 4.16e-103 SMART
low complexity region 301 324 N/A INTRINSIC
low complexity region 370 381 N/A INTRINSIC
Pfam:Mst1_SARAH 443 490 9.6e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000067033
AA Change: D183G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000064225
Gene: ENSMUSG00000022329
AA Change: D183G

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 5 205 2.1e-41 PFAM
Pfam:Pkinase 5 208 1.2e-56 PFAM
coiled coil region 217 256 N/A INTRINSIC
low complexity region 300 311 N/A INTRINSIC
Pfam:Mst1_SARAH 372 420 9.8e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226555
AA Change: D251G

PolyPhen 2 Score 0.427 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.4962 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.5%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine protein kinase activated by proapoptotic molecules indicating the encoded protein functions as a growth suppressor. Cleavage of the protein product by caspase removes the inhibitory C-terminal portion. The N-terminal portion is transported to the nucleus where it homodimerizes to form the active kinase which promotes the condensation of chromatin during apoptosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous inactivation of this gene generally results in mice that are viable, fertile and developmentally normal. A small subset of mice homozygous for a knock-out allele develop mammary tumors in the absence of immunological defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 A G 7: 46,135,468 probably benign Het
Acbd3 T A 1: 180,738,530 Y263N probably damaging Het
Aldh4a1 T C 4: 139,635,519 V142A probably benign Het
Car9 G T 4: 43,512,439 probably null Het
Cass4 T C 2: 172,416,495 S138P probably damaging Het
Cbln4 T C 2: 172,037,456 K171E possibly damaging Het
Cd226 A G 18: 89,247,174 Y79C probably damaging Het
Dclre1a T C 19: 56,545,163 D333G probably damaging Het
Dst T A 1: 34,229,248 probably null Het
Eml5 A G 12: 98,831,003 probably benign Het
Evx1 T C 6: 52,317,010 S388P probably damaging Het
Gins1 T A 2: 150,930,848 L177* probably null Het
Gm5422 A C 10: 31,250,735 noncoding transcript Het
Gmppa T A 1: 75,440,534 D204E probably benign Het
Ifna7 A C 4: 88,816,660 T145P possibly damaging Het
Inhbb T C 1: 119,420,695 D131G probably benign Het
Itpr2 T C 6: 146,111,742 K2679E probably damaging Het
Kif20b C A 19: 34,924,635 H4N probably benign Het
Kng1 G T 16: 23,067,694 probably null Het
Lrrfip1 C T 1: 91,115,367 A498V probably benign Het
Myo3a T A 2: 22,323,675 probably null Het
Nkapl T C 13: 21,468,060 R128G unknown Het
Olfr1350 A T 7: 6,570,783 Y264F probably benign Het
Olfr624 T C 7: 103,670,311 H240R probably damaging Het
Prlr T C 15: 10,328,786 V449A probably benign Het
Rbm44 C A 1: 91,153,042 D317E probably damaging Het
Sirt5 T C 13: 43,394,807 S310P probably damaging Het
Spice1 T C 16: 44,386,822 S856P probably damaging Het
Sptan1 T A 2: 30,021,187 probably benign Het
St6gal1 A G 16: 23,321,651 K191E probably damaging Het
Stat6 A T 10: 127,650,811 Q152L probably benign Het
Tas2r139 C T 6: 42,140,940 A2V probably benign Het
Tfpi2 A G 6: 3,968,281 L15P probably damaging Het
Topbp1 T A 9: 103,347,008 C1445S probably benign Het
Trappc11 A T 8: 47,525,046 H195Q possibly damaging Het
Ttc21a A T 9: 119,954,652 E600V possibly damaging Het
Ttn T C 2: 76,846,697 probably benign Het
Vmn2r88 T C 14: 51,418,550 S740P probably damaging Het
Wrn A C 8: 33,294,916 V476G probably benign Het
Zdbf2 C A 1: 63,303,053 A197E probably damaging Het
Other mutations in Stk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Stk3 APN 15 35114622 missense possibly damaging 0.93
IGL02133:Stk3 APN 15 35099516 missense probably damaging 1.00
IGL03121:Stk3 APN 15 35099426 splice site probably benign
IGL03309:Stk3 APN 15 35099551 splice site probably benign
R0276:Stk3 UTSW 15 35099469 missense probably damaging 1.00
R0416:Stk3 UTSW 15 35114632 missense probably benign 0.07
R1633:Stk3 UTSW 15 34959060 missense probably damaging 1.00
R1638:Stk3 UTSW 15 35008308 splice site probably null
R1917:Stk3 UTSW 15 35073217 missense probably damaging 1.00
R1919:Stk3 UTSW 15 35073217 missense probably damaging 1.00
R2011:Stk3 UTSW 15 35072498 missense probably damaging 1.00
R2072:Stk3 UTSW 15 34959049 missense possibly damaging 0.79
R2073:Stk3 UTSW 15 34959049 missense possibly damaging 0.79
R2075:Stk3 UTSW 15 34959049 missense possibly damaging 0.79
R3158:Stk3 UTSW 15 35008241 missense possibly damaging 0.83
R3402:Stk3 UTSW 15 34944998 splice site probably benign
R4633:Stk3 UTSW 15 34958928 missense probably damaging 0.99
R4672:Stk3 UTSW 15 35099457 missense probably benign 0.06
R4687:Stk3 UTSW 15 35114565 missense probably damaging 0.99
R4825:Stk3 UTSW 15 34999908 missense probably benign 0.14
R4903:Stk3 UTSW 15 34959066 missense probably damaging 0.99
R5390:Stk3 UTSW 15 35114560 nonsense probably null
R5834:Stk3 UTSW 15 34959018 missense probably damaging 1.00
R7208:Stk3 UTSW 15 35073116 missense possibly damaging 0.76
R7266:Stk3 UTSW 15 34959036 missense probably benign 0.05
X0021:Stk3 UTSW 15 35072555 missense probably damaging 1.00
X0060:Stk3 UTSW 15 35114533 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCATGTGTCACAACTCCATGTTTTCA -3'
(R):5'- ACAGACTTGGTTCCCCAATTGCATTAT -3'

Sequencing Primer
(F):5'- CAATCTTTAGACAGTCCTGAGACTC -3'
(R):5'- CCCAATTGCATTATCGCAGG -3'
Posted On2014-02-11