Incidental Mutation 'R1352:Kng1'
ID 156717
Institutional Source Beutler Lab
Gene Symbol Kng1
Ensembl Gene ENSMUSG00000022875
Gene Name kininogen 1
Synonyms H-kininigen, L-kininogen
MMRRC Submission 039417-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1352 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 23057865-23082078 bp(+) (GRCm38)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) G to T at 23067694 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023589] [ENSMUST00000023589] [ENSMUST00000023589] [ENSMUST00000039492] [ENSMUST00000039492] [ENSMUST00000039492] [ENSMUST00000089902] [ENSMUST00000089902] [ENSMUST00000089902] [ENSMUST00000125790] [ENSMUST00000125790] [ENSMUST00000125790]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000023589
SMART Domains Protein: ENSMUSP00000023589
Gene: ENSMUSG00000022875

DomainStartEndE-ValueType
CY 18 126 3.61e-17 SMART
CY 140 248 6.46e-28 SMART
CY 262 370 2.96e-36 SMART
low complexity region 439 450 N/A INTRINSIC
low complexity region 494 524 N/A INTRINSIC
low complexity region 541 555 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000023589
SMART Domains Protein: ENSMUSP00000023589
Gene: ENSMUSG00000022875

DomainStartEndE-ValueType
CY 18 126 3.61e-17 SMART
CY 140 248 6.46e-28 SMART
CY 262 370 2.96e-36 SMART
low complexity region 439 450 N/A INTRINSIC
low complexity region 494 524 N/A INTRINSIC
low complexity region 541 555 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000023589
SMART Domains Protein: ENSMUSP00000023589
Gene: ENSMUSG00000022875

DomainStartEndE-ValueType
CY 18 126 3.61e-17 SMART
CY 140 248 6.46e-28 SMART
CY 262 370 2.96e-36 SMART
low complexity region 439 450 N/A INTRINSIC
low complexity region 494 524 N/A INTRINSIC
low complexity region 541 555 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000039492
SMART Domains Protein: ENSMUSP00000040485
Gene: ENSMUSG00000022875

DomainStartEndE-ValueType
CY 18 126 3.61e-17 SMART
CY 140 248 6.46e-28 SMART
CY 262 370 2.96e-36 SMART
Predicted Effect probably null
Transcript: ENSMUST00000039492
SMART Domains Protein: ENSMUSP00000040485
Gene: ENSMUSG00000022875

DomainStartEndE-ValueType
CY 18 126 3.61e-17 SMART
CY 140 248 6.46e-28 SMART
CY 262 370 2.96e-36 SMART
Predicted Effect probably null
Transcript: ENSMUST00000039492
SMART Domains Protein: ENSMUSP00000040485
Gene: ENSMUSG00000022875

DomainStartEndE-ValueType
CY 18 126 3.61e-17 SMART
CY 140 248 6.46e-28 SMART
CY 262 370 2.96e-36 SMART
Predicted Effect probably null
Transcript: ENSMUST00000089902
SMART Domains Protein: ENSMUSP00000087346
Gene: ENSMUSG00000022875

DomainStartEndE-ValueType
CY 18 126 3.61e-17 SMART
CY 140 248 6.46e-28 SMART
CY 262 370 2.96e-36 SMART
Predicted Effect probably null
Transcript: ENSMUST00000089902
SMART Domains Protein: ENSMUSP00000087346
Gene: ENSMUSG00000022875

DomainStartEndE-ValueType
CY 18 126 3.61e-17 SMART
CY 140 248 6.46e-28 SMART
CY 262 370 2.96e-36 SMART
Predicted Effect probably null
Transcript: ENSMUST00000089902
SMART Domains Protein: ENSMUSP00000087346
Gene: ENSMUSG00000022875

DomainStartEndE-ValueType
CY 18 126 3.61e-17 SMART
CY 140 248 6.46e-28 SMART
CY 262 370 2.96e-36 SMART
Predicted Effect probably null
Transcript: ENSMUST00000125790
SMART Domains Protein: ENSMUSP00000121701
Gene: ENSMUSG00000022875

DomainStartEndE-ValueType
Pfam:Cystatin 1 62 6.5e-11 PFAM
Pfam:Cystatin 89 134 1.1e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000125790
SMART Domains Protein: ENSMUSP00000121701
Gene: ENSMUSG00000022875

DomainStartEndE-ValueType
Pfam:Cystatin 1 62 6.5e-11 PFAM
Pfam:Cystatin 89 134 1.1e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000125790
SMART Domains Protein: ENSMUSP00000121701
Gene: ENSMUSG00000022875

DomainStartEndE-ValueType
Pfam:Cystatin 1 62 6.5e-11 PFAM
Pfam:Cystatin 89 134 1.1e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136778
Meta Mutation Damage Score 0.9490 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.5%
Validation Efficiency 95% (42/44)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted null mutation are viable and grossly unaffected with normal tail vein bleeding times, despite loss of detectable plasma kininogen. However, homozygotes show a significantly longer time to carotid artery occlusion after RoseBengal and laser-induced arterial injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 A G 7: 46,135,468 probably benign Het
Acbd3 T A 1: 180,738,530 Y263N probably damaging Het
Aldh4a1 T C 4: 139,635,519 V142A probably benign Het
Car9 G T 4: 43,512,439 probably null Het
Cass4 T C 2: 172,416,495 S138P probably damaging Het
Cbln4 T C 2: 172,037,456 K171E possibly damaging Het
Cd226 A G 18: 89,247,174 Y79C probably damaging Het
Dclre1a T C 19: 56,545,163 D333G probably damaging Het
Dst T A 1: 34,229,248 probably null Het
Eml5 A G 12: 98,831,003 probably benign Het
Evx1 T C 6: 52,317,010 S388P probably damaging Het
Gins1 T A 2: 150,930,848 L177* probably null Het
Gm5422 A C 10: 31,250,735 noncoding transcript Het
Gmppa T A 1: 75,440,534 D204E probably benign Het
Ifna7 A C 4: 88,816,660 T145P possibly damaging Het
Inhbb T C 1: 119,420,695 D131G probably benign Het
Itpr2 T C 6: 146,111,742 K2679E probably damaging Het
Kif20b C A 19: 34,924,635 H4N probably benign Het
Lrrfip1 C T 1: 91,115,367 A498V probably benign Het
Myo3a T A 2: 22,323,675 probably null Het
Nkapl T C 13: 21,468,060 R128G unknown Het
Olfr1350 A T 7: 6,570,783 Y264F probably benign Het
Olfr624 T C 7: 103,670,311 H240R probably damaging Het
Prlr T C 15: 10,328,786 V449A probably benign Het
Rbm44 C A 1: 91,153,042 D317E probably damaging Het
Sirt5 T C 13: 43,394,807 S310P probably damaging Het
Spice1 T C 16: 44,386,822 S856P probably damaging Het
Sptan1 T A 2: 30,021,187 probably benign Het
St6gal1 A G 16: 23,321,651 K191E probably damaging Het
Stat6 A T 10: 127,650,811 Q152L probably benign Het
Stk3 T C 15: 35,008,225 D253G probably damaging Het
Tas2r139 C T 6: 42,140,940 A2V probably benign Het
Tfpi2 A G 6: 3,968,281 L15P probably damaging Het
Topbp1 T A 9: 103,347,008 C1445S probably benign Het
Trappc11 A T 8: 47,525,046 H195Q possibly damaging Het
Ttc21a A T 9: 119,954,652 E600V possibly damaging Het
Ttn T C 2: 76,846,697 probably benign Het
Vmn2r88 T C 14: 51,418,550 S740P probably damaging Het
Wrn A C 8: 33,294,916 V476G probably benign Het
Zdbf2 C A 1: 63,303,053 A197E probably damaging Het
Other mutations in Kng1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01460:Kng1 APN 16 23079194 missense probably benign 0.26
IGL01754:Kng1 APN 16 23079614 missense probably benign 0.10
IGL02049:Kng1 APN 16 23073437 missense probably damaging 0.99
IGL02138:Kng1 APN 16 23067808 missense probably damaging 0.99
IGL02216:Kng1 APN 16 23058533 missense probably damaging 0.98
IGL02230:Kng1 APN 16 23060494 critical splice donor site probably null
IGL02630:Kng1 APN 16 23079845 utr 3 prime probably benign
IGL03024:Kng1 APN 16 23074692 missense possibly damaging 0.92
R0518:Kng1 UTSW 16 23060482 missense possibly damaging 0.70
R0521:Kng1 UTSW 16 23060482 missense possibly damaging 0.70
R1396:Kng1 UTSW 16 23078980 missense probably benign 0.00
R1514:Kng1 UTSW 16 23079760 missense probably damaging 0.97
R1753:Kng1 UTSW 16 23079119 missense possibly damaging 0.68
R2048:Kng1 UTSW 16 23058604 missense probably damaging 0.98
R2290:Kng1 UTSW 16 23079125 missense possibly damaging 0.79
R2357:Kng1 UTSW 16 23079065 missense possibly damaging 0.88
R3014:Kng1 UTSW 16 23079370 missense possibly damaging 0.72
R3607:Kng1 UTSW 16 23067802 missense probably damaging 1.00
R4322:Kng1 UTSW 16 23079520 missense probably benign
R4334:Kng1 UTSW 16 23079620 missense possibly damaging 0.88
R4388:Kng1 UTSW 16 23079318 missense possibly damaging 0.63
R4558:Kng1 UTSW 16 23077418 splice site probably null
R4887:Kng1 UTSW 16 23067698 missense possibly damaging 0.71
R5115:Kng1 UTSW 16 23069282 missense possibly damaging 0.87
R5288:Kng1 UTSW 16 23079092 missense probably damaging 0.96
R5461:Kng1 UTSW 16 23079137 missense probably benign 0.19
R5894:Kng1 UTSW 16 23073363 missense probably benign 0.08
R6137:Kng1 UTSW 16 23074645 missense possibly damaging 0.56
R6260:Kng1 UTSW 16 23058621 missense possibly damaging 0.66
R6291:Kng1 UTSW 16 23079725 missense probably damaging 1.00
R6620:Kng1 UTSW 16 23081482 missense possibly damaging 0.74
R6947:Kng1 UTSW 16 23077374 missense probably benign 0.21
R7142:Kng1 UTSW 16 23079420 missense probably benign 0.25
R7166:Kng1 UTSW 16 23079678 missense probably benign 0.00
R7168:Kng1 UTSW 16 23079641 missense probably benign 0.26
R7347:Kng1 UTSW 16 23067787 missense possibly damaging 0.46
R9005:Kng1 UTSW 16 23079396 missense probably damaging 0.99
R9388:Kng1 UTSW 16 23079638 missense possibly damaging 0.84
R9563:Kng1 UTSW 16 23060420 missense probably damaging 1.00
R9689:Kng1 UTSW 16 23060474 missense probably damaging 0.98
Z1176:Kng1 UTSW 16 23079616 missense probably benign 0.00
Z1177:Kng1 UTSW 16 23073389 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- CCATCTTTGCTTTTGACTGCACAGG -3'
(R):5'- ATGGAAACACGGGCACTCTAGGAC -3'

Sequencing Primer
(F):5'- TCTCAGGGGTTTAGGACCAT -3'
(R):5'- CACTCTAGGACGATGCCAG -3'
Posted On 2014-02-11