Incidental Mutation 'R1352:Spice1'
ID156719
Institutional Source Beutler Lab
Gene Symbol Spice1
Ensembl Gene ENSMUSG00000043065
Gene Namespindle and centriole associated protein 1
SynonymsCcdc52, D16Ertd480e
MMRRC Submission 039417-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1352 (G1)
Quality Score216
Status Validated
Chromosome16
Chromosomal Location44347121-44388497 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44386822 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 856 (S856P)
Ref Sequence ENSEMBL: ENSMUSP00000058832 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050897]
Predicted Effect probably damaging
Transcript: ENSMUST00000050897
AA Change: S856P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000058832
Gene: ENSMUSG00000043065
AA Change: S856P

DomainStartEndE-ValueType
Pfam:SPICE 33 436 1.4e-151 PFAM
low complexity region 627 642 N/A INTRINSIC
coiled coil region 729 757 N/A INTRINSIC
low complexity region 758 775 N/A INTRINSIC
low complexity region 804 824 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126228
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133168
Meta Mutation Damage Score 0.1560 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.5%
Validation Efficiency 95% (42/44)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 A G 7: 46,135,468 probably benign Het
Acbd3 T A 1: 180,738,530 Y263N probably damaging Het
Aldh4a1 T C 4: 139,635,519 V142A probably benign Het
Car9 G T 4: 43,512,439 probably null Het
Cass4 T C 2: 172,416,495 S138P probably damaging Het
Cbln4 T C 2: 172,037,456 K171E possibly damaging Het
Cd226 A G 18: 89,247,174 Y79C probably damaging Het
Dclre1a T C 19: 56,545,163 D333G probably damaging Het
Dst T A 1: 34,229,248 probably null Het
Eml5 A G 12: 98,831,003 probably benign Het
Evx1 T C 6: 52,317,010 S388P probably damaging Het
Gins1 T A 2: 150,930,848 L177* probably null Het
Gm5422 A C 10: 31,250,735 noncoding transcript Het
Gmppa T A 1: 75,440,534 D204E probably benign Het
Ifna7 A C 4: 88,816,660 T145P possibly damaging Het
Inhbb T C 1: 119,420,695 D131G probably benign Het
Itpr2 T C 6: 146,111,742 K2679E probably damaging Het
Kif20b C A 19: 34,924,635 H4N probably benign Het
Kng1 G T 16: 23,067,694 probably null Het
Lrrfip1 C T 1: 91,115,367 A498V probably benign Het
Myo3a T A 2: 22,323,675 probably null Het
Nkapl T C 13: 21,468,060 R128G unknown Het
Olfr1350 A T 7: 6,570,783 Y264F probably benign Het
Olfr624 T C 7: 103,670,311 H240R probably damaging Het
Prlr T C 15: 10,328,786 V449A probably benign Het
Rbm44 C A 1: 91,153,042 D317E probably damaging Het
Sirt5 T C 13: 43,394,807 S310P probably damaging Het
Sptan1 T A 2: 30,021,187 probably benign Het
St6gal1 A G 16: 23,321,651 K191E probably damaging Het
Stat6 A T 10: 127,650,811 Q152L probably benign Het
Stk3 T C 15: 35,008,225 D253G probably damaging Het
Tas2r139 C T 6: 42,140,940 A2V probably benign Het
Tfpi2 A G 6: 3,968,281 L15P probably damaging Het
Topbp1 T A 9: 103,347,008 C1445S probably benign Het
Trappc11 A T 8: 47,525,046 H195Q possibly damaging Het
Ttc21a A T 9: 119,954,652 E600V possibly damaging Het
Ttn T C 2: 76,846,697 probably benign Het
Vmn2r88 T C 14: 51,418,550 S740P probably damaging Het
Wrn A C 8: 33,294,916 V476G probably benign Het
Zdbf2 C A 1: 63,303,053 A197E probably damaging Het
Other mutations in Spice1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01393:Spice1 APN 16 44366630 missense probably benign 0.20
IGL01688:Spice1 APN 16 44384710 missense probably benign 0.04
IGL03259:Spice1 APN 16 44356167 missense probably damaging 1.00
IGL03367:Spice1 APN 16 44356178 missense probably damaging 0.99
R0230:Spice1 UTSW 16 44365576 splice site probably benign
R0944:Spice1 UTSW 16 44384761 missense probably benign
R1888:Spice1 UTSW 16 44365626 missense probably damaging 1.00
R1888:Spice1 UTSW 16 44365626 missense probably damaging 1.00
R1894:Spice1 UTSW 16 44365626 missense probably damaging 1.00
R1907:Spice1 UTSW 16 44357830 nonsense probably null
R2404:Spice1 UTSW 16 44366626 missense probably benign 0.29
R2444:Spice1 UTSW 16 44366568 nonsense probably null
R3551:Spice1 UTSW 16 44357869 missense probably damaging 0.96
R3848:Spice1 UTSW 16 44378891 nonsense probably null
R3857:Spice1 UTSW 16 44355443 missense probably damaging 1.00
R4490:Spice1 UTSW 16 44382113 missense probably damaging 1.00
R5593:Spice1 UTSW 16 44370752 missense possibly damaging 0.50
R5996:Spice1 UTSW 16 44384674 missense probably benign 0.00
R6303:Spice1 UTSW 16 44370697 missense probably benign 0.03
R6552:Spice1 UTSW 16 44379033 missense possibly damaging 0.75
R7042:Spice1 UTSW 16 44385680 missense probably benign 0.04
R7062:Spice1 UTSW 16 44357896 missense probably damaging 1.00
R7065:Spice1 UTSW 16 44355535 missense probably damaging 1.00
R7115:Spice1 UTSW 16 44379275 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAGGACACCTGCTGAACAGGCAAC -3'
(R):5'- GCTTTACTCACAGGGAATTAGAGGTGC -3'

Sequencing Primer
(F):5'- GTCTTCGTGGGCAGGAGC -3'
(R):5'- GGTGCTTTGTTGAAAAAACATTTG -3'
Posted On2014-02-11