Incidental Mutation 'R1352:Cd226'
ID156720
Institutional Source Beutler Lab
Gene Symbol Cd226
Ensembl Gene ENSMUSG00000034028
Gene NameCD226 antigen
SynonymsTLiSA1, DNAM-1, Pta1, DNAM1
MMRRC Submission 039417-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1352 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location89197431-89270201 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89247174 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 79 (Y79C)
Ref Sequence ENSEMBL: ENSMUSP00000095104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037142] [ENSMUST00000097496]
Predicted Effect probably damaging
Transcript: ENSMUST00000037142
AA Change: Y192C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043551
Gene: ENSMUSG00000034028
AA Change: Y192C

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 22 126 4.46e-1 SMART
IG 138 243 9.26e-8 SMART
transmembrane domain 252 274 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097496
AA Change: Y79C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095104
Gene: ENSMUSG00000034028
AA Change: Y79C

DomainStartEndE-ValueType
IG 25 130 9.26e-8 SMART
transmembrane domain 139 161 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.5%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein expressed on the surface of NK cells, platelets, monocytes and a subset of T cells. It is a member of the Ig-superfamily containing 2 Ig-like domains of the V-set. The protein mediates cellular adhesion of platelets and megakaryocytic cells to vascular endothelial cells. The protein also plays a role in megakaryocytic cell maturation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired NK cell cytolysis and increased incidence of tumor formation and mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 A G 7: 46,135,468 probably benign Het
Acbd3 T A 1: 180,738,530 Y263N probably damaging Het
Aldh4a1 T C 4: 139,635,519 V142A probably benign Het
Car9 G T 4: 43,512,439 probably null Het
Cass4 T C 2: 172,416,495 S138P probably damaging Het
Cbln4 T C 2: 172,037,456 K171E possibly damaging Het
Dclre1a T C 19: 56,545,163 D333G probably damaging Het
Dst T A 1: 34,229,248 probably null Het
Eml5 A G 12: 98,831,003 probably benign Het
Evx1 T C 6: 52,317,010 S388P probably damaging Het
Gins1 T A 2: 150,930,848 L177* probably null Het
Gm5422 A C 10: 31,250,735 noncoding transcript Het
Gmppa T A 1: 75,440,534 D204E probably benign Het
Ifna7 A C 4: 88,816,660 T145P possibly damaging Het
Inhbb T C 1: 119,420,695 D131G probably benign Het
Itpr2 T C 6: 146,111,742 K2679E probably damaging Het
Kif20b C A 19: 34,924,635 H4N probably benign Het
Kng1 G T 16: 23,067,694 probably null Het
Lrrfip1 C T 1: 91,115,367 A498V probably benign Het
Myo3a T A 2: 22,323,675 probably null Het
Nkapl T C 13: 21,468,060 R128G unknown Het
Olfr1350 A T 7: 6,570,783 Y264F probably benign Het
Olfr624 T C 7: 103,670,311 H240R probably damaging Het
Prlr T C 15: 10,328,786 V449A probably benign Het
Rbm44 C A 1: 91,153,042 D317E probably damaging Het
Sirt5 T C 13: 43,394,807 S310P probably damaging Het
Spice1 T C 16: 44,386,822 S856P probably damaging Het
Sptan1 T A 2: 30,021,187 probably benign Het
St6gal1 A G 16: 23,321,651 K191E probably damaging Het
Stat6 A T 10: 127,650,811 Q152L probably benign Het
Stk3 T C 15: 35,008,225 D253G probably damaging Het
Tas2r139 C T 6: 42,140,940 A2V probably benign Het
Tfpi2 A G 6: 3,968,281 L15P probably damaging Het
Topbp1 T A 9: 103,347,008 C1445S probably benign Het
Trappc11 A T 8: 47,525,046 H195Q possibly damaging Het
Ttc21a A T 9: 119,954,652 E600V possibly damaging Het
Ttn T C 2: 76,846,697 probably benign Het
Vmn2r88 T C 14: 51,418,550 S740P probably damaging Het
Wrn A C 8: 33,294,916 V476G probably benign Het
Zdbf2 C A 1: 63,303,053 A197E probably damaging Het
Other mutations in Cd226
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01682:Cd226 APN 18 89269063 missense probably damaging 1.00
IGL02292:Cd226 APN 18 89207092 missense possibly damaging 0.55
IGL02298:Cd226 APN 18 89207051 missense probably damaging 1.00
IGL02408:Cd226 APN 18 89207327 missense probably benign
R0179:Cd226 UTSW 18 89207139 missense probably benign 0.00
R0558:Cd226 UTSW 18 89207214 missense probably benign 0.30
R0602:Cd226 UTSW 18 89269011 missense probably benign 0.00
R0744:Cd226 UTSW 18 89207020 intron probably benign
R0833:Cd226 UTSW 18 89207020 intron probably benign
R1125:Cd226 UTSW 18 89267922 missense probably benign
R1355:Cd226 UTSW 18 89247023 missense probably benign 0.10
R1370:Cd226 UTSW 18 89247023 missense probably benign 0.10
R1998:Cd226 UTSW 18 89207219 missense probably damaging 1.00
R2004:Cd226 UTSW 18 89247311 missense probably benign 0.03
R2006:Cd226 UTSW 18 89247311 missense probably benign 0.03
R2045:Cd226 UTSW 18 89207362 missense probably benign 0.10
R2354:Cd226 UTSW 18 89246983 critical splice acceptor site probably null
R2518:Cd226 UTSW 18 89207327 missense probably benign
R4603:Cd226 UTSW 18 89207219 missense probably damaging 1.00
R4804:Cd226 UTSW 18 89207168 missense possibly damaging 0.89
R5964:Cd226 UTSW 18 89207183 missense probably benign 0.02
R5999:Cd226 UTSW 18 89207219 missense probably damaging 1.00
R7205:Cd226 UTSW 18 89247198 missense probably damaging 1.00
R7456:Cd226 UTSW 18 89206623 missense probably damaging 0.96
R7509:Cd226 UTSW 18 89247071 missense probably benign 0.10
R7714:Cd226 UTSW 18 89247309 missense probably damaging 1.00
X0024:Cd226 UTSW 18 89263285 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATAGCAGCACCCTCGGATAGCTAC -3'
(R):5'- GACCAATTCAAGGTCGTTGGGTTTG -3'

Sequencing Primer
(F):5'- ACTTGGCCAGTGCAACAA -3'
(R):5'- TACTAGAAACATATCCTGTCACTCAC -3'
Posted On2014-02-11