Incidental Mutation 'R1352:Kif20b'
Institutional Source Beutler Lab
Gene Symbol Kif20b
Ensembl Gene ENSMUSG00000024795
Gene Namekinesin family member 20B
SynonymsKif20b, Mphosph1, N-6 kinesin
MMRRC Submission 039417-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.858) question?
Stock #R1352 (G1)
Quality Score225
Status Validated
Chromosomal Location34922361-34975745 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 34924635 bp
Amino Acid Change Histidine to Asparagine at position 4 (H4N)
Ref Sequence ENSEMBL: ENSMUSP00000153034 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087341] [ENSMUST00000223776] [ENSMUST00000223907]
Predicted Effect probably benign
Transcript: ENSMUST00000087341
AA Change: H4N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000084599
Gene: ENSMUSG00000024795
AA Change: H4N

Blast:KISc 2 46 5e-15 BLAST
KISc 56 483 1.19e-103 SMART
low complexity region 521 551 N/A INTRINSIC
coiled coil region 565 602 N/A INTRINSIC
coiled coil region 705 746 N/A INTRINSIC
coiled coil region 823 947 N/A INTRINSIC
coiled coil region 1020 1325 N/A INTRINSIC
coiled coil region 1348 1510 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223776
AA Change: H4N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000223907
AA Change: H4N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.5%
Validation Efficiency 95% (42/44)
MGI Phenotype PHENOTYPE: Mice homozygous for ENU induced mutations display craniofacial and nervous system abnormalities including exencephaly, microcephaly, decreased forebrain size and impaired neuronal progenitor proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 A G 7: 46,135,468 probably benign Het
Acbd3 T A 1: 180,738,530 Y263N probably damaging Het
Aldh4a1 T C 4: 139,635,519 V142A probably benign Het
Car9 G T 4: 43,512,439 probably null Het
Cass4 T C 2: 172,416,495 S138P probably damaging Het
Cbln4 T C 2: 172,037,456 K171E possibly damaging Het
Cd226 A G 18: 89,247,174 Y79C probably damaging Het
Dclre1a T C 19: 56,545,163 D333G probably damaging Het
Dst T A 1: 34,229,248 probably null Het
Eml5 A G 12: 98,831,003 probably benign Het
Evx1 T C 6: 52,317,010 S388P probably damaging Het
Gins1 T A 2: 150,930,848 L177* probably null Het
Gm5422 A C 10: 31,250,735 noncoding transcript Het
Gmppa T A 1: 75,440,534 D204E probably benign Het
Ifna7 A C 4: 88,816,660 T145P possibly damaging Het
Inhbb T C 1: 119,420,695 D131G probably benign Het
Itpr2 T C 6: 146,111,742 K2679E probably damaging Het
Kng1 G T 16: 23,067,694 probably null Het
Lrrfip1 C T 1: 91,115,367 A498V probably benign Het
Myo3a T A 2: 22,323,675 probably null Het
Nkapl T C 13: 21,468,060 R128G unknown Het
Olfr1350 A T 7: 6,570,783 Y264F probably benign Het
Olfr624 T C 7: 103,670,311 H240R probably damaging Het
Prlr T C 15: 10,328,786 V449A probably benign Het
Rbm44 C A 1: 91,153,042 D317E probably damaging Het
Sirt5 T C 13: 43,394,807 S310P probably damaging Het
Spice1 T C 16: 44,386,822 S856P probably damaging Het
Sptan1 T A 2: 30,021,187 probably benign Het
St6gal1 A G 16: 23,321,651 K191E probably damaging Het
Stat6 A T 10: 127,650,811 Q152L probably benign Het
Stk3 T C 15: 35,008,225 D253G probably damaging Het
Tas2r139 C T 6: 42,140,940 A2V probably benign Het
Tfpi2 A G 6: 3,968,281 L15P probably damaging Het
Topbp1 T A 9: 103,347,008 C1445S probably benign Het
Trappc11 A T 8: 47,525,046 H195Q possibly damaging Het
Ttc21a A T 9: 119,954,652 E600V possibly damaging Het
Ttn T C 2: 76,846,697 probably benign Het
Vmn2r88 T C 14: 51,418,550 S740P probably damaging Het
Wrn A C 8: 33,294,916 V476G probably benign Het
Zdbf2 C A 1: 63,303,053 A197E probably damaging Het
Other mutations in Kif20b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Kif20b APN 19 34947660 missense possibly damaging 0.77
IGL01021:Kif20b APN 19 34938260 missense possibly damaging 0.89
IGL01590:Kif20b APN 19 34954726 missense possibly damaging 0.87
IGL01691:Kif20b APN 19 34935743 splice site probably benign
IGL01730:Kif20b APN 19 34950523 nonsense probably null
IGL02078:Kif20b APN 19 34935644 missense probably damaging 1.00
IGL02174:Kif20b APN 19 34934458 splice site probably benign
IGL02536:Kif20b APN 19 34974559 missense probably benign 0.42
IGL03029:Kif20b APN 19 34950913 missense probably benign
IGL03186:Kif20b APN 19 34934944 missense probably benign 0.45
IGL03205:Kif20b APN 19 34959463 missense probably damaging 1.00
IGL03493:Kif20b APN 19 34959550 nonsense probably null
R0319:Kif20b UTSW 19 34947732 splice site probably benign
R1069:Kif20b UTSW 19 34950851 missense probably damaging 1.00
R1137:Kif20b UTSW 19 34937086 critical splice donor site probably null
R1255:Kif20b UTSW 19 34950106 missense probably benign 0.08
R1466:Kif20b UTSW 19 34950599 missense probably benign 0.00
R1466:Kif20b UTSW 19 34950599 missense probably benign 0.00
R1473:Kif20b UTSW 19 34974496 missense possibly damaging 0.93
R1545:Kif20b UTSW 19 34928918 missense probably damaging 1.00
R1647:Kif20b UTSW 19 34936790 missense possibly damaging 0.65
R1648:Kif20b UTSW 19 34936790 missense possibly damaging 0.65
R1752:Kif20b UTSW 19 34938336 missense probably benign 0.13
R1835:Kif20b UTSW 19 34956038 missense probably damaging 1.00
R1889:Kif20b UTSW 19 34941208 unclassified probably benign
R1937:Kif20b UTSW 19 34952878 missense possibly damaging 0.73
R2112:Kif20b UTSW 19 34931732 missense probably benign 0.04
R2315:Kif20b UTSW 19 34931599 missense probably damaging 1.00
R2385:Kif20b UTSW 19 34959419 missense probably damaging 0.98
R2867:Kif20b UTSW 19 34940128 missense probably damaging 1.00
R2867:Kif20b UTSW 19 34940128 missense probably damaging 1.00
R3086:Kif20b UTSW 19 34929715 missense probably damaging 1.00
R3116:Kif20b UTSW 19 34970080 missense probably benign 0.38
R3407:Kif20b UTSW 19 34950500 missense probably damaging 1.00
R3834:Kif20b UTSW 19 34935028 missense probably damaging 1.00
R3882:Kif20b UTSW 19 34950080 missense probably damaging 1.00
R4698:Kif20b UTSW 19 34951544 missense probably damaging 1.00
R4721:Kif20b UTSW 19 34938373 missense probably benign 0.41
R4883:Kif20b UTSW 19 34966122 missense probably benign 0.00
R4901:Kif20b UTSW 19 34934436 missense probably benign 0.00
R4923:Kif20b UTSW 19 34941211 critical splice acceptor site probably null
R5538:Kif20b UTSW 19 34952964 nonsense probably null
R5540:Kif20b UTSW 19 34938460 missense probably benign 0.01
R5558:Kif20b UTSW 19 34951549 missense probably damaging 1.00
R5580:Kif20b UTSW 19 34949728 splice site probably null
R5934:Kif20b UTSW 19 34941321 missense probably benign 0.02
R6019:Kif20b UTSW 19 34950464 missense probably benign 0.00
R6464:Kif20b UTSW 19 34934441 missense probably benign
R6613:Kif20b UTSW 19 34936984 nonsense probably null
R6745:Kif20b UTSW 19 34928876 missense possibly damaging 0.94
R7097:Kif20b UTSW 19 34974492 missense probably damaging 0.98
R7237:Kif20b UTSW 19 34950605 missense probably damaging 1.00
R7260:Kif20b UTSW 19 34950210 missense probably damaging 1.00
R7373:Kif20b UTSW 19 34935671 missense probably damaging 1.00
R7418:Kif20b UTSW 19 34929687 missense probably damaging 0.99
R7814:Kif20b UTSW 19 34950955 missense possibly damaging 0.63
Z1088:Kif20b UTSW 19 34950451 missense probably damaging 0.99
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- agatgacctggaacttggtg -3'
Posted On2014-02-11