Incidental Mutation 'R1352:Dclre1a'
ID156722
Institutional Source Beutler Lab
Gene Symbol Dclre1a
Ensembl Gene ENSMUSG00000025077
Gene NameDNA cross-link repair 1A
Synonyms2810043H12Rik, SMN1a, SNM1, mSNM1
MMRRC Submission 039417-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1352 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location56529167-56548222 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56545163 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 333 (D333G)
Ref Sequence ENSEMBL: ENSMUSP00000138290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071423] [ENSMUST00000182059] [ENSMUST00000182276] [ENSMUST00000183143]
Predicted Effect probably damaging
Transcript: ENSMUST00000026063
AA Change: D315G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026063
Gene: ENSMUSG00000025077
AA Change: D315G

DomainStartEndE-ValueType
low complexity region 72 92 N/A INTRINSIC
low complexity region 193 202 N/A INTRINSIC
low complexity region 528 542 N/A INTRINSIC
Lactamase_B 687 835 7.86e-1 SMART
Pfam:DRMBL 903 1009 1.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071423
SMART Domains Protein: ENSMUSP00000071370
Gene: ENSMUSG00000025078

DomainStartEndE-ValueType
Pfam:Thioredoxin_8 78 174 2.7e-14 PFAM
LY 216 258 8.44e0 SMART
Pfam:NHL 278 304 2.3e-9 PFAM
low complexity region 321 331 N/A INTRINSIC
Blast:LY 402 446 5e-8 BLAST
LY 467 509 1.91e0 SMART
Pfam:NHL 530 558 1.2e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181992
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182058
Predicted Effect probably benign
Transcript: ENSMUST00000182059
Predicted Effect probably damaging
Transcript: ENSMUST00000182276
AA Change: D333G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138290
Gene: ENSMUSG00000025077
AA Change: D333G

DomainStartEndE-ValueType
low complexity region 90 110 N/A INTRINSIC
low complexity region 211 220 N/A INTRINSIC
low complexity region 546 560 N/A INTRINSIC
Lactamase_B 705 853 7.86e-1 SMART
Pfam:DRMBL 921 1027 1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183143
SMART Domains Protein: ENSMUSP00000138537
Gene: ENSMUSG00000025077

DomainStartEndE-ValueType
low complexity region 90 110 N/A INTRINSIC
Meta Mutation Damage Score 0.0940 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.5%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved protein that is involved in the repair of DNA interstrand cross-links. DNA cross-links suppress transcription, replication, and DNA segregation. The encoded protein is a regulator of the mitotic cell cycle checkpoint. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable and fertile but exhibit increased sensitivity to the DNA interstrand cross-linking agent mitomycin C. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 A G 7: 46,135,468 probably benign Het
Acbd3 T A 1: 180,738,530 Y263N probably damaging Het
Aldh4a1 T C 4: 139,635,519 V142A probably benign Het
Car9 G T 4: 43,512,439 probably null Het
Cass4 T C 2: 172,416,495 S138P probably damaging Het
Cbln4 T C 2: 172,037,456 K171E possibly damaging Het
Cd226 A G 18: 89,247,174 Y79C probably damaging Het
Dst T A 1: 34,229,248 probably null Het
Eml5 A G 12: 98,831,003 probably benign Het
Evx1 T C 6: 52,317,010 S388P probably damaging Het
Gins1 T A 2: 150,930,848 L177* probably null Het
Gm5422 A C 10: 31,250,735 noncoding transcript Het
Gmppa T A 1: 75,440,534 D204E probably benign Het
Ifna7 A C 4: 88,816,660 T145P possibly damaging Het
Inhbb T C 1: 119,420,695 D131G probably benign Het
Itpr2 T C 6: 146,111,742 K2679E probably damaging Het
Kif20b C A 19: 34,924,635 H4N probably benign Het
Kng1 G T 16: 23,067,694 probably null Het
Lrrfip1 C T 1: 91,115,367 A498V probably benign Het
Myo3a T A 2: 22,323,675 probably null Het
Nkapl T C 13: 21,468,060 R128G unknown Het
Olfr1350 A T 7: 6,570,783 Y264F probably benign Het
Olfr624 T C 7: 103,670,311 H240R probably damaging Het
Prlr T C 15: 10,328,786 V449A probably benign Het
Rbm44 C A 1: 91,153,042 D317E probably damaging Het
Sirt5 T C 13: 43,394,807 S310P probably damaging Het
Spice1 T C 16: 44,386,822 S856P probably damaging Het
Sptan1 T A 2: 30,021,187 probably benign Het
St6gal1 A G 16: 23,321,651 K191E probably damaging Het
Stat6 A T 10: 127,650,811 Q152L probably benign Het
Stk3 T C 15: 35,008,225 D253G probably damaging Het
Tas2r139 C T 6: 42,140,940 A2V probably benign Het
Tfpi2 A G 6: 3,968,281 L15P probably damaging Het
Topbp1 T A 9: 103,347,008 C1445S probably benign Het
Trappc11 A T 8: 47,525,046 H195Q possibly damaging Het
Ttc21a A T 9: 119,954,652 E600V possibly damaging Het
Ttn T C 2: 76,846,697 probably benign Het
Vmn2r88 T C 14: 51,418,550 S740P probably damaging Het
Wrn A C 8: 33,294,916 V476G probably benign Het
Zdbf2 C A 1: 63,303,053 A197E probably damaging Het
Other mutations in Dclre1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01655:Dclre1a APN 19 56547057 missense probably damaging 1.00
IGL02113:Dclre1a APN 19 56541532 missense probably damaging 0.98
IGL02264:Dclre1a APN 19 56544293 missense possibly damaging 0.93
IGL03303:Dclre1a APN 19 56546766 missense possibly damaging 0.85
Gof UTSW 19 56542709 missense probably damaging 1.00
Hoopla UTSW 19 56546635 critical splice donor site probably null
FR4589:Dclre1a UTSW 19 56544123 utr 3 prime probably benign
PIT4377001:Dclre1a UTSW 19 56544405 missense probably benign 0.05
R0081:Dclre1a UTSW 19 56542707 missense probably damaging 1.00
R0355:Dclre1a UTSW 19 56546635 critical splice donor site probably null
R0422:Dclre1a UTSW 19 56544135 nonsense probably null
R0486:Dclre1a UTSW 19 56541490 splice site probably benign
R0619:Dclre1a UTSW 19 56545409 missense probably benign 0.00
R0639:Dclre1a UTSW 19 56538440 missense probably damaging 1.00
R1221:Dclre1a UTSW 19 56531268 missense possibly damaging 0.69
R1824:Dclre1a UTSW 19 56546718 unclassified probably null
R1833:Dclre1a UTSW 19 56541500 splice site probably null
R3851:Dclre1a UTSW 19 56541507 missense probably damaging 1.00
R3889:Dclre1a UTSW 19 56545320 missense probably benign 0.00
R4373:Dclre1a UTSW 19 56545442 missense probably benign 0.04
R5277:Dclre1a UTSW 19 56544732 missense possibly damaging 0.78
R5747:Dclre1a UTSW 19 56541532 missense probably damaging 0.98
R5792:Dclre1a UTSW 19 56529590 missense probably damaging 1.00
R5892:Dclre1a UTSW 19 56547140 missense probably benign 0.29
R5993:Dclre1a UTSW 19 56542737 missense probably damaging 1.00
R6368:Dclre1a UTSW 19 56546791 missense probably benign 0.02
R6706:Dclre1a UTSW 19 56545069 missense probably benign 0.11
R6944:Dclre1a UTSW 19 56545019 missense possibly damaging 0.90
R6960:Dclre1a UTSW 19 56542709 missense probably damaging 1.00
R7023:Dclre1a UTSW 19 56540206 missense probably damaging 0.99
R7213:Dclre1a UTSW 19 56529635 missense probably damaging 1.00
R7355:Dclre1a UTSW 19 56547135 missense possibly damaging 0.53
R7413:Dclre1a UTSW 19 56542650 missense probably damaging 1.00
R7577:Dclre1a UTSW 19 56529533 missense probably damaging 1.00
R7840:Dclre1a UTSW 19 56531252 missense probably damaging 1.00
R7923:Dclre1a UTSW 19 56531252 missense probably damaging 1.00
RF031:Dclre1a UTSW 19 56544132 utr 3 prime probably benign
RF046:Dclre1a UTSW 19 56544132 utr 3 prime probably benign
Predicted Primers PCR Primer
(F):5'- GCAGAGAAGTCTGATTGCCAACAGC -3'
(R):5'- GTGCAGAGTTCGTCAAGAGAGACC -3'

Sequencing Primer
(F):5'- CTGGTCTGATAATTAGAAGCAGCAC -3'
(R):5'- TATGGGTTTGCCATTGCCAG -3'
Posted On2014-02-11