Incidental Mutation 'R1332:Rif1'
ID 156728
Institutional Source Beutler Lab
Gene Symbol Rif1
Ensembl Gene ENSMUSG00000036202
Gene Name replication timing regulatory factor 1
Synonyms D2Ertd145e, 6530403D07Rik, 5730435J01Rik
MMRRC Submission 039397-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1332 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 51962844-52012395 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 51968326 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 170 (W170R)
Ref Sequence ENSEMBL: ENSMUSP00000108313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069794] [ENSMUST00000112693] [ENSMUST00000126218]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000069794
AA Change: W170R

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000064155
Gene: ENSMUSG00000036202
AA Change: W170R

DomainStartEndE-ValueType
Pfam:Rif1_N 22 368 3.3e-78 PFAM
low complexity region 432 444 N/A INTRINSIC
low complexity region 586 598 N/A INTRINSIC
low complexity region 1018 1038 N/A INTRINSIC
low complexity region 1180 1205 N/A INTRINSIC
low complexity region 1310 1321 N/A INTRINSIC
low complexity region 1423 1446 N/A INTRINSIC
low complexity region 1576 1586 N/A INTRINSIC
low complexity region 1677 1690 N/A INTRINSIC
low complexity region 1702 1712 N/A INTRINSIC
low complexity region 2176 2195 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112693
AA Change: W170R

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000108313
Gene: ENSMUSG00000036202
AA Change: W170R

DomainStartEndE-ValueType
Pfam:Rif1_N 18 381 1.4e-85 PFAM
low complexity region 432 444 N/A INTRINSIC
low complexity region 586 598 N/A INTRINSIC
low complexity region 1018 1038 N/A INTRINSIC
low complexity region 1180 1205 N/A INTRINSIC
low complexity region 1310 1321 N/A INTRINSIC
low complexity region 1423 1446 N/A INTRINSIC
low complexity region 1576 1586 N/A INTRINSIC
low complexity region 1677 1690 N/A INTRINSIC
low complexity region 1702 1712 N/A INTRINSIC
low complexity region 2176 2195 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126218
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 93.0%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that shares homology with the yeast teleomere binding protein, Rap1 interacting factor 1. This protein localizes to aberrant telomeres may be involved in DNA repair. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. Mice homozygous for a gene trap allele exhibit embryonic and postnatal lethality, reduced fertility, and decreased cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933415A04Rik T TNNNNNNNNNNNNNNNNNN 11: 43,478,256 (GRCm39) probably benign Het
Abhd14b A T 9: 106,329,195 (GRCm39) I42F probably damaging Het
Apbb1 A T 7: 105,214,750 (GRCm39) I498N possibly damaging Het
Asah2 A G 19: 32,022,341 (GRCm39) I231T probably damaging Het
Bid C T 6: 120,874,216 (GRCm39) A110T possibly damaging Het
Caskin2 C T 11: 115,694,171 (GRCm39) probably benign Het
Ccdc141 T C 2: 76,844,784 (GRCm39) T1428A probably damaging Het
Cd22 A C 7: 30,569,912 (GRCm39) W477G possibly damaging Het
Cox16 T C 12: 81,519,064 (GRCm39) D89G probably damaging Het
Dnah17 A G 11: 117,934,041 (GRCm39) I3511T possibly damaging Het
Dpy19l4 A T 4: 11,276,901 (GRCm39) Y333N probably damaging Het
Eya2 T C 2: 165,529,528 (GRCm39) probably benign Het
Fras1 A G 5: 96,855,167 (GRCm39) D1892G probably benign Het
Hlf G T 11: 90,231,679 (GRCm39) S265* probably null Het
Immt T C 6: 71,823,256 (GRCm39) probably benign Het
Lair1 T C 7: 4,013,595 (GRCm39) E36G possibly damaging Het
Lrfn5 T C 12: 61,904,314 (GRCm39) probably benign Het
Nos1ap T C 1: 170,177,001 (GRCm39) N134S probably damaging Het
Ogfod1 T C 8: 94,784,727 (GRCm39) C344R probably damaging Het
Or6c212 A G 10: 129,559,116 (GRCm39) L99S probably damaging Het
Pkhd1l1 G A 15: 44,368,943 (GRCm39) V863I probably damaging Het
Pmfbp1 T G 8: 110,256,898 (GRCm39) I534S probably damaging Het
Prex2 A G 1: 11,274,315 (GRCm39) D1329G probably damaging Het
Rasal2 T C 1: 157,003,391 (GRCm39) T423A probably benign Het
Scarb2 C T 5: 92,599,205 (GRCm39) probably null Het
Stard9 C A 2: 120,504,117 (GRCm39) S221R probably damaging Het
Tlr3 A C 8: 45,851,774 (GRCm39) N374K probably damaging Het
Uck1 T C 2: 32,149,666 (GRCm39) D71G probably damaging Het
Vcan C T 13: 89,841,174 (GRCm39) E497K probably damaging Het
Vmn2r86 G A 10: 130,282,739 (GRCm39) L626F probably damaging Het
Vmn2r89 A G 14: 51,692,559 (GRCm39) T121A probably benign Het
Wdr64 T C 1: 175,622,706 (GRCm39) S828P possibly damaging Het
Zfp334 A T 2: 165,222,776 (GRCm39) H422Q probably damaging Het
Other mutations in Rif1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Rif1 APN 2 52,011,019 (GRCm39) missense probably damaging 0.96
IGL00711:Rif1 APN 2 52,001,082 (GRCm39) missense probably benign 0.00
IGL00721:Rif1 APN 2 52,009,129 (GRCm39) missense probably damaging 1.00
IGL01085:Rif1 APN 2 51,975,152 (GRCm39) missense possibly damaging 0.71
IGL01093:Rif1 APN 2 51,985,960 (GRCm39) missense probably damaging 1.00
IGL01107:Rif1 APN 2 52,001,315 (GRCm39) missense probably benign 0.00
IGL01138:Rif1 APN 2 52,001,534 (GRCm39) missense probably damaging 1.00
IGL01844:Rif1 APN 2 52,002,555 (GRCm39) missense probably benign 0.07
IGL02441:Rif1 APN 2 51,995,527 (GRCm39) missense probably benign 0.00
IGL02448:Rif1 APN 2 52,006,708 (GRCm39) missense probably damaging 0.99
IGL02563:Rif1 APN 2 51,967,077 (GRCm39) missense probably damaging 1.00
IGL02704:Rif1 APN 2 51,983,588 (GRCm39) missense probably damaging 1.00
IGL02946:Rif1 APN 2 52,000,137 (GRCm39) nonsense probably null
IGL03060:Rif1 APN 2 52,002,149 (GRCm39) missense probably damaging 0.97
IGL03206:Rif1 APN 2 51,993,634 (GRCm39) missense probably damaging 1.00
IGL03263:Rif1 APN 2 51,980,273 (GRCm39) missense probably damaging 0.99
IGL03267:Rif1 APN 2 51,967,000 (GRCm39) missense possibly damaging 0.94
IGL03280:Rif1 APN 2 52,002,611 (GRCm39) missense probably benign 0.32
hifi UTSW 2 52,000,336 (GRCm39) unclassified probably benign
nietzsche UTSW 2 51,967,032 (GRCm39) missense probably benign 0.08
PIT4305001:Rif1 UTSW 2 52,001,970 (GRCm39) missense
R0017:Rif1 UTSW 2 52,006,686 (GRCm39) missense probably benign 0.18
R0017:Rif1 UTSW 2 52,006,686 (GRCm39) missense probably benign 0.18
R0060:Rif1 UTSW 2 52,001,129 (GRCm39) missense probably damaging 1.00
R0060:Rif1 UTSW 2 52,001,129 (GRCm39) missense probably damaging 1.00
R0104:Rif1 UTSW 2 52,000,104 (GRCm39) missense possibly damaging 0.77
R0268:Rif1 UTSW 2 51,980,298 (GRCm39) critical splice donor site probably null
R0276:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0278:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0288:Rif1 UTSW 2 52,000,025 (GRCm39) missense probably damaging 1.00
R0314:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0345:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0346:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0383:Rif1 UTSW 2 51,975,153 (GRCm39) missense probably damaging 0.96
R0384:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0387:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0388:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0456:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0477:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0505:Rif1 UTSW 2 52,000,749 (GRCm39) missense probably damaging 0.99
R0510:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0511:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0512:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0633:Rif1 UTSW 2 52,002,575 (GRCm39) missense probably benign 0.00
R0637:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0638:Rif1 UTSW 2 52,001,600 (GRCm39) missense probably benign 0.12
R0666:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0675:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0707:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0726:Rif1 UTSW 2 52,000,365 (GRCm39) missense possibly damaging 0.52
R0743:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0744:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0938:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0939:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0940:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0941:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0942:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0943:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1006:Rif1 UTSW 2 51,975,041 (GRCm39) missense probably damaging 0.99
R1052:Rif1 UTSW 2 52,001,574 (GRCm39) missense probably benign 0.01
R1061:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1175:Rif1 UTSW 2 51,997,640 (GRCm39) unclassified probably benign
R1183:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1184:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1271:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1336:Rif1 UTSW 2 51,968,326 (GRCm39) missense probably benign 0.06
R1351:Rif1 UTSW 2 52,001,567 (GRCm39) missense possibly damaging 0.74
R1517:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1527:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1560:Rif1 UTSW 2 52,001,143 (GRCm39) missense probably damaging 1.00
R1563:Rif1 UTSW 2 51,963,235 (GRCm39) missense probably damaging 0.99
R1571:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1625:Rif1 UTSW 2 51,993,652 (GRCm39) missense probably benign 0.25
R1679:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1689:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1731:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1744:Rif1 UTSW 2 52,002,404 (GRCm39) missense possibly damaging 0.56
R1746:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1748:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1831:Rif1 UTSW 2 51,968,507 (GRCm39) nonsense probably null
R1902:Rif1 UTSW 2 52,006,685 (GRCm39) missense possibly damaging 0.93
R1964:Rif1 UTSW 2 51,988,421 (GRCm39) missense probably benign 0.01
R1978:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2000:Rif1 UTSW 2 51,971,310 (GRCm39) missense probably damaging 0.99
R2030:Rif1 UTSW 2 51,982,358 (GRCm39) missense probably damaging 1.00
R2056:Rif1 UTSW 2 51,983,588 (GRCm39) missense probably damaging 1.00
R2106:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2109:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2125:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2126:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2145:Rif1 UTSW 2 52,001,412 (GRCm39) missense possibly damaging 0.63
R2152:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2153:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2213:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2327:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2512:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2513:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2516:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2520:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2905:Rif1 UTSW 2 51,988,516 (GRCm39) missense probably damaging 0.99
R3005:Rif1 UTSW 2 51,972,776 (GRCm39) missense probably damaging 1.00
R3155:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R3156:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R3429:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R3707:Rif1 UTSW 2 51,983,592 (GRCm39) missense probably damaging 1.00
R3907:Rif1 UTSW 2 52,002,557 (GRCm39) missense probably benign 0.03
R3978:Rif1 UTSW 2 52,006,759 (GRCm39) critical splice donor site probably null
R4023:Rif1 UTSW 2 52,011,099 (GRCm39) missense probably benign 0.01
R4052:Rif1 UTSW 2 51,988,483 (GRCm39) nonsense probably null
R4668:Rif1 UTSW 2 52,001,964 (GRCm39) missense probably benign 0.01
R4674:Rif1 UTSW 2 51,996,954 (GRCm39) missense probably null 1.00
R4715:Rif1 UTSW 2 51,963,151 (GRCm39) utr 5 prime probably benign
R4766:Rif1 UTSW 2 51,988,946 (GRCm39) missense probably damaging 1.00
R4783:Rif1 UTSW 2 52,002,759 (GRCm39) missense probably damaging 0.96
R4785:Rif1 UTSW 2 52,002,759 (GRCm39) missense probably damaging 0.96
R4869:Rif1 UTSW 2 51,983,623 (GRCm39) intron probably benign
R4911:Rif1 UTSW 2 52,000,530 (GRCm39) missense probably damaging 0.98
R4951:Rif1 UTSW 2 51,974,998 (GRCm39) splice site probably null
R5044:Rif1 UTSW 2 51,999,940 (GRCm39) missense probably damaging 0.99
R5088:Rif1 UTSW 2 51,982,307 (GRCm39) missense possibly damaging 0.91
R5151:Rif1 UTSW 2 52,010,321 (GRCm39) missense probably damaging 1.00
R5187:Rif1 UTSW 2 51,971,301 (GRCm39) missense probably damaging 1.00
R5222:Rif1 UTSW 2 51,967,032 (GRCm39) missense probably benign 0.08
R5243:Rif1 UTSW 2 52,001,836 (GRCm39) missense possibly damaging 0.86
R5436:Rif1 UTSW 2 52,010,983 (GRCm39) intron probably benign
R5476:Rif1 UTSW 2 51,979,607 (GRCm39) missense probably damaging 1.00
R5496:Rif1 UTSW 2 51,988,928 (GRCm39) missense probably damaging 1.00
R5641:Rif1 UTSW 2 52,011,170 (GRCm39) missense possibly damaging 0.80
R5883:Rif1 UTSW 2 51,995,651 (GRCm39) critical splice donor site probably null
R5987:Rif1 UTSW 2 51,985,856 (GRCm39) missense probably damaging 1.00
R5990:Rif1 UTSW 2 51,985,856 (GRCm39) missense probably damaging 1.00
R5992:Rif1 UTSW 2 51,985,856 (GRCm39) missense probably damaging 1.00
R6019:Rif1 UTSW 2 51,985,856 (GRCm39) missense probably damaging 1.00
R6020:Rif1 UTSW 2 51,985,856 (GRCm39) missense probably damaging 1.00
R6255:Rif1 UTSW 2 51,975,065 (GRCm39) missense probably damaging 1.00
R6342:Rif1 UTSW 2 52,009,168 (GRCm39) missense probably damaging 0.97
R6364:Rif1 UTSW 2 51,997,681 (GRCm39) missense probably damaging 0.97
R6747:Rif1 UTSW 2 51,968,275 (GRCm39) splice site probably null
R6928:Rif1 UTSW 2 51,985,973 (GRCm39) missense probably damaging 1.00
R6954:Rif1 UTSW 2 52,002,703 (GRCm39) missense probably benign 0.00
R7003:Rif1 UTSW 2 51,967,001 (GRCm39) missense probably benign 0.06
R7310:Rif1 UTSW 2 51,995,631 (GRCm39) missense probably benign 0.12
R7549:Rif1 UTSW 2 51,968,519 (GRCm39) missense possibly damaging 0.52
R7603:Rif1 UTSW 2 51,966,187 (GRCm39) missense probably damaging 1.00
R7673:Rif1 UTSW 2 51,978,666 (GRCm39) missense probably damaging 1.00
R7741:Rif1 UTSW 2 51,975,153 (GRCm39) missense probably damaging 0.96
R7777:Rif1 UTSW 2 52,006,368 (GRCm39) missense probably benign 0.00
R7910:Rif1 UTSW 2 51,968,399 (GRCm39) nonsense probably null
R7962:Rif1 UTSW 2 51,964,288 (GRCm39) missense probably damaging 1.00
R8264:Rif1 UTSW 2 51,980,290 (GRCm39) missense noncoding transcript
R8390:Rif1 UTSW 2 52,000,935 (GRCm39) missense probably damaging 1.00
R8479:Rif1 UTSW 2 52,002,563 (GRCm39) missense possibly damaging 0.52
R8490:Rif1 UTSW 2 52,001,011 (GRCm39) missense probably damaging 0.96
R8762:Rif1 UTSW 2 52,001,742 (GRCm39) missense
R8785:Rif1 UTSW 2 52,000,493 (GRCm39) missense probably benign 0.06
R8890:Rif1 UTSW 2 51,988,875 (GRCm39) missense probably damaging 0.99
R9081:Rif1 UTSW 2 52,000,989 (GRCm39) missense probably damaging 0.99
R9225:Rif1 UTSW 2 52,001,862 (GRCm39) missense probably benign 0.22
R9284:Rif1 UTSW 2 51,998,564 (GRCm39) missense probably benign 0.00
R9300:Rif1 UTSW 2 52,001,151 (GRCm39) missense probably damaging 1.00
R9366:Rif1 UTSW 2 52,010,356 (GRCm39) missense
R9477:Rif1 UTSW 2 52,001,342 (GRCm39) missense probably benign 0.02
R9522:Rif1 UTSW 2 51,971,311 (GRCm39) missense probably damaging 1.00
R9573:Rif1 UTSW 2 52,000,466 (GRCm39) missense probably benign 0.29
R9630:Rif1 UTSW 2 51,979,607 (GRCm39) missense probably damaging 1.00
X0064:Rif1 UTSW 2 51,984,645 (GRCm39) missense probably damaging 0.96
X0064:Rif1 UTSW 2 51,964,327 (GRCm39) missense probably benign 0.00
Z1177:Rif1 UTSW 2 51,978,660 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAGTGAGCCTAGCCAGGAGCATC -3'
(R):5'- TTCTGAAGCAGCAATGGCATCCCC -3'

Sequencing Primer
(F):5'- AGCCAGGAGCATCTTTGTACC -3'
(R):5'- GCAATGGCATCCCCATCTC -3'
Posted On 2014-02-11