Incidental Mutation 'R1332:Zfp334'
ID156731
Institutional Source Beutler Lab
Gene Symbol Zfp334
Ensembl Gene ENSMUSG00000017667
Gene Namezinc finger protein 334
SynonymsD2Ertd535e
MMRRC Submission 039397-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1332 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location165374264-165388259 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 165380856 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 422 (H422Q)
Ref Sequence ENSEMBL: ENSMUSP00000099373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103084]
Predicted Effect probably damaging
Transcript: ENSMUST00000103084
AA Change: H422Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099373
Gene: ENSMUSG00000017667
AA Change: H422Q

DomainStartEndE-ValueType
KRAB 8 68 5.91e-35 SMART
ZnF_C2H2 236 258 5.42e-2 SMART
ZnF_C2H2 264 286 1.2e-3 SMART
ZnF_C2H2 292 314 6.99e-5 SMART
ZnF_C2H2 320 342 1.22e-4 SMART
ZnF_C2H2 348 370 3.39e-3 SMART
ZnF_C2H2 376 398 7.15e-2 SMART
ZnF_C2H2 404 426 1.69e-3 SMART
ZnF_C2H2 432 454 1.92e-2 SMART
ZnF_C2H2 460 482 3.16e-3 SMART
ZnF_C2H2 543 565 1.82e-3 SMART
ZnF_C2H2 571 593 3.69e-4 SMART
ZnF_C2H2 599 621 1.58e-3 SMART
ZnF_C2H2 627 649 1.38e-3 SMART
ZnF_C2H2 655 677 3.89e-3 SMART
Meta Mutation Damage Score 0.6968 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 93.0%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the C2H2 zinc finger family. The encoded protein contains a Krueppel-associated box, fourteen C2H2 zinc finger domains, and four C2H2-type/integrase DNA-binding domains. Decreased expression of this gene may be a marker for rheumatoid arthritis. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933415A04Rik T TNNNNNNNNNNNNNNNNNN 11: 43,587,429 probably benign Het
Abhd14b A T 9: 106,451,996 I42F probably damaging Het
Apbb1 A T 7: 105,565,543 I498N possibly damaging Het
Asah2 A G 19: 32,044,941 I231T probably damaging Het
Bid C T 6: 120,897,255 A110T possibly damaging Het
Caskin2 C T 11: 115,803,345 probably benign Het
Ccdc141 T C 2: 77,014,440 T1428A probably damaging Het
Cd22 A C 7: 30,870,487 W477G possibly damaging Het
Cox16 T C 12: 81,472,290 D89G probably damaging Het
Dnah17 A G 11: 118,043,215 I3511T possibly damaging Het
Dpy19l4 A T 4: 11,276,901 Y333N probably damaging Het
Eya2 T C 2: 165,687,608 probably benign Het
Fras1 A G 5: 96,707,308 D1892G probably benign Het
Hlf G T 11: 90,340,853 S265* probably null Het
Immt T C 6: 71,846,272 probably benign Het
Lair1 T C 7: 4,010,596 E36G possibly damaging Het
Lrfn5 T C 12: 61,857,528 probably benign Het
Nos1ap T C 1: 170,349,432 N134S probably damaging Het
Ogfod1 T C 8: 94,058,099 C344R probably damaging Het
Olfr805 A G 10: 129,723,247 L99S probably damaging Het
Pkhd1l1 G A 15: 44,505,547 V863I probably damaging Het
Pmfbp1 T G 8: 109,530,266 I534S probably damaging Het
Prex2 A G 1: 11,204,091 D1329G probably damaging Het
Rasal2 T C 1: 157,175,821 T423A probably benign Het
Rif1 T A 2: 52,078,314 W170R probably benign Het
Scarb2 C T 5: 92,451,346 probably null Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Tlr3 A C 8: 45,398,737 N374K probably damaging Het
Uck1 T C 2: 32,259,654 D71G probably damaging Het
Vcan C T 13: 89,693,055 E497K probably damaging Het
Vmn2r86 G A 10: 130,446,870 L626F probably damaging Het
Vmn2r89 A G 14: 51,455,102 T121A probably benign Het
Wdr64 T C 1: 175,795,140 S828P possibly damaging Het
Other mutations in Zfp334
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02097:Zfp334 APN 2 165381723 nonsense probably null
IGL02185:Zfp334 APN 2 165386949 utr 5 prime probably benign
IGL02415:Zfp334 APN 2 165381851 missense possibly damaging 0.70
IGL02693:Zfp334 APN 2 165380513 missense possibly damaging 0.80
ANU23:Zfp334 UTSW 2 165381097 missense probably damaging 1.00
R0040:Zfp334 UTSW 2 165381572 missense probably benign 0.45
R1579:Zfp334 UTSW 2 165381799 missense probably damaging 0.98
R2429:Zfp334 UTSW 2 165380512 missense probably damaging 1.00
R5556:Zfp334 UTSW 2 165380584 missense probably benign
R5579:Zfp334 UTSW 2 165380487 nonsense probably null
R6891:Zfp334 UTSW 2 165382724 missense probably benign
R6918:Zfp334 UTSW 2 165381879 missense possibly damaging 0.46
R8360:Zfp334 UTSW 2 165383358 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTCAGGTAGAAAAGCTTCCCACACTC -3'
(R):5'- TCCGAGCATCGTGAAGGTGAACAG -3'

Sequencing Primer
(F):5'- ACTCGGGACACTCGAAGG -3'
(R):5'- gcaaggagtgtggcaaag -3'
Posted On2014-02-11