Incidental Mutation 'R1332:Hlf'
ID156748
Institutional Source Beutler Lab
Gene Symbol Hlf
Ensembl Gene ENSMUSG00000003949
Gene Namehepatic leukemia factor
Synonyms
MMRRC Submission 039397-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.608) question?
Stock #R1332 (G1)
Quality Score213
Status Validated
Chromosome11
Chromosomal Location90336536-90390895 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 90340853 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 265 (S265*)
Ref Sequence ENSEMBL: ENSMUSP00000004051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004051]
Predicted Effect probably null
Transcript: ENSMUST00000004051
AA Change: S265*
SMART Domains Protein: ENSMUSP00000004051
Gene: ENSMUSG00000003949
AA Change: S265*

DomainStartEndE-ValueType
low complexity region 41 56 N/A INTRINSIC
low complexity region 98 111 N/A INTRINSIC
BRLZ 223 287 1.12e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000043658
Predicted Effect noncoding transcript
Transcript: ENSMUST00000107881
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137957
Predicted Effect probably benign
Transcript: ENSMUST00000176001
Meta Mutation Damage Score 0.9717 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 93.0%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the proline and acidic-rich (PAR) protein family, a subset of the bZIP transcription factors. The encoded protein forms homodimers or heterodimers with other PAR family members and binds sequence-specific promoter elements to activate transcription. Chromosomal translocations fusing portions of this gene with the E2A gene cause a subset of childhood B-lineage acute lymphoid leukemias. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933415A04Rik T TNNNNNNNNNNNNNNNNNN 11: 43,587,429 probably benign Het
Abhd14b A T 9: 106,451,996 I42F probably damaging Het
Apbb1 A T 7: 105,565,543 I498N possibly damaging Het
Asah2 A G 19: 32,044,941 I231T probably damaging Het
Bid C T 6: 120,897,255 A110T possibly damaging Het
Caskin2 C T 11: 115,803,345 probably benign Het
Ccdc141 T C 2: 77,014,440 T1428A probably damaging Het
Cd22 A C 7: 30,870,487 W477G possibly damaging Het
Cox16 T C 12: 81,472,290 D89G probably damaging Het
Dnah17 A G 11: 118,043,215 I3511T possibly damaging Het
Dpy19l4 A T 4: 11,276,901 Y333N probably damaging Het
Eya2 T C 2: 165,687,608 probably benign Het
Fras1 A G 5: 96,707,308 D1892G probably benign Het
Immt T C 6: 71,846,272 probably benign Het
Lair1 T C 7: 4,010,596 E36G possibly damaging Het
Lrfn5 T C 12: 61,857,528 probably benign Het
Nos1ap T C 1: 170,349,432 N134S probably damaging Het
Ogfod1 T C 8: 94,058,099 C344R probably damaging Het
Olfr805 A G 10: 129,723,247 L99S probably damaging Het
Pkhd1l1 G A 15: 44,505,547 V863I probably damaging Het
Pmfbp1 T G 8: 109,530,266 I534S probably damaging Het
Prex2 A G 1: 11,204,091 D1329G probably damaging Het
Rasal2 T C 1: 157,175,821 T423A probably benign Het
Rif1 T A 2: 52,078,314 W170R probably benign Het
Scarb2 C T 5: 92,451,346 probably null Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Tlr3 A C 8: 45,398,737 N374K probably damaging Het
Uck1 T C 2: 32,259,654 D71G probably damaging Het
Vcan C T 13: 89,693,055 E497K probably damaging Het
Vmn2r86 G A 10: 130,446,870 L626F probably damaging Het
Vmn2r89 A G 14: 51,455,102 T121A probably benign Het
Wdr64 T C 1: 175,795,140 S828P possibly damaging Het
Zfp334 A T 2: 165,380,856 H422Q probably damaging Het
Other mutations in Hlf
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0312:Hlf UTSW 11 90387875 missense possibly damaging 0.82
R1863:Hlf UTSW 11 90340826 missense probably damaging 0.99
R3177:Hlf UTSW 11 90345835 missense probably damaging 1.00
R3277:Hlf UTSW 11 90345835 missense probably damaging 1.00
R3809:Hlf UTSW 11 90388103 missense probably benign 0.38
R5129:Hlf UTSW 11 90390252 missense probably benign
R5249:Hlf UTSW 11 90387806 missense probably benign 0.01
R7751:Hlf UTSW 11 90387995 missense probably damaging 0.99
X0023:Hlf UTSW 11 90345751 splice site probably benign
Predicted Primers PCR Primer
(F):5'- GCTGACCACACATGGGACCATAAG -3'
(R):5'- ACTGGCACACAACTGCATTGGG -3'

Sequencing Primer
(F):5'- acacacacacaaacatacatacatac -3'
(R):5'- ATGGCTGGCAGATCATACC -3'
Posted On2014-02-11