Incidental Mutation 'R1333:Stxbp5l'
ID 156790
Institutional Source Beutler Lab
Gene Symbol Stxbp5l
Ensembl Gene ENSMUSG00000022829
Gene Name syntaxin binding protein 5-like
Synonyms insulin level locus 1, T2dm1, LLGL4, tomosyn-2, t2md1, A830015P08Rik
MMRRC Submission 039398-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1333 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 36935304-37205324 bp(-) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to A at 37068231 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110435 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023526] [ENSMUST00000114775] [ENSMUST00000114780] [ENSMUST00000114781] [ENSMUST00000114782] [ENSMUST00000114787]
AlphaFold Q5DQR4
Predicted Effect noncoding transcript
Transcript: ENSMUST00000023526
SMART Domains Protein: ENSMUSP00000023526
Gene: ENSMUSG00000022829

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
Blast:WD40 143 182 2e-20 BLAST
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 284 396 7.6e-45 PFAM
WD40 397 476 7.7e-1 SMART
WD40 501 541 6.14e1 SMART
low complexity region 577 592 N/A INTRINSIC
low complexity region 790 804 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114775
SMART Domains Protein: ENSMUSP00000110423
Gene: ENSMUSG00000022829

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 284 396 3.5e-45 PFAM
Blast:WD40 397 466 6e-43 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000114780
SMART Domains Protein: ENSMUSP00000110428
Gene: ENSMUSG00000022829

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
Blast:WD40 143 182 1e-20 BLAST
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 284 396 8.6e-45 PFAM
WD40 397 476 7.7e-1 SMART
WD40 501 541 6.14e1 SMART
low complexity region 577 592 N/A INTRINSIC
Pfam:Lgl_C 731 988 3e-9 PFAM
PDB:1URQ|A 1038 1097 2e-25 PDB
Predicted Effect probably null
Transcript: ENSMUST00000114781
SMART Domains Protein: ENSMUSP00000110429
Gene: ENSMUSG00000022829

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
Blast:WD40 143 182 1e-20 BLAST
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 284 396 8.9e-45 PFAM
WD40 397 476 7.7e-1 SMART
WD40 501 541 6.14e1 SMART
low complexity region 577 592 N/A INTRINSIC
Pfam:Lgl_C 755 1012 3.1e-9 PFAM
PDB:1URQ|A 1062 1121 2e-25 PDB
Predicted Effect probably null
Transcript: ENSMUST00000114782
SMART Domains Protein: ENSMUSP00000110430
Gene: ENSMUSG00000022829

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
Blast:WD40 143 182 1e-20 BLAST
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 284 396 9.2e-45 PFAM
WD40 397 476 7.7e-1 SMART
WD40 501 541 6.14e1 SMART
low complexity region 577 592 N/A INTRINSIC
Pfam:Lgl_C 785 1045 3.1e-9 PFAM
PDB:1URQ|A 1095 1154 2e-25 PDB
Predicted Effect probably null
Transcript: ENSMUST00000114787
SMART Domains Protein: ENSMUSP00000110435
Gene: ENSMUSG00000022829

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
Blast:WD40 143 182 1e-20 BLAST
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 287 396 8.7e-35 PFAM
WD40 397 476 7.7e-1 SMART
WD40 501 541 6.14e1 SMART
low complexity region 577 592 N/A INTRINSIC
Pfam:Lgl_C 811 1069 3.3e-9 PFAM
PDB:1URQ|A 1119 1178 2e-25 PDB
Meta Mutation Damage Score 0.9496 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 90.3%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to syntaxin-binding protein 5 and contains ten N-terminal WD40 repeats, four variable region WD40 repeats, and a C-terminal R-SNARE domain. Studies of the orthologous proteins in mouse and rat have shown that the encoded protein may inhibit exocytosis in neurosecretory cells, and may negatively regulate the secretion of insulin. A missense variant in this gene is likely the cause of an infantile-onset neurodegenerative disorder diagnosed in two siblings of consanguineous parents. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a QTL derived from BTBR exhibit increased fasting serum glucose and decreased fasting serum insulin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts18 A G 8: 114,431,805 (GRCm39) probably benign Het
Amph G A 13: 19,326,198 (GRCm39) V643M probably damaging Het
Amt A G 9: 108,178,296 (GRCm39) D301G probably benign Het
Arhgef26 T C 3: 62,247,744 (GRCm39) V276A probably benign Het
Bid C T 6: 120,874,216 (GRCm39) A110T possibly damaging Het
Ccdc63 T C 5: 122,246,224 (GRCm39) T566A probably benign Het
Cdk5rap1 A G 2: 154,202,574 (GRCm39) S219P probably damaging Het
Col1a2 T A 6: 4,515,684 (GRCm39) probably null Het
Ctns G A 11: 73,075,823 (GRCm39) T342I probably benign Het
Dst G A 1: 34,267,428 (GRCm39) E4957K probably damaging Het
Elp1 C T 4: 56,770,969 (GRCm39) probably benign Het
Fam163b A G 2: 27,003,659 (GRCm39) probably benign Het
Frem2 T C 3: 53,457,152 (GRCm39) T2067A probably benign Het
Gm7353 C T 7: 3,159,066 (GRCm39) noncoding transcript Het
Gm9791 T C 3: 34,059,225 (GRCm39) noncoding transcript Het
Grik2 G T 10: 49,404,087 (GRCm39) T258N probably damaging Het
Herc3 T C 6: 58,864,478 (GRCm39) L704P probably damaging Het
Hjurp A C 1: 88,193,768 (GRCm39) V380G probably damaging Het
Lrrc56 A G 7: 140,778,177 (GRCm39) probably benign Het
Mast3 G A 8: 71,233,938 (GRCm39) P187S probably damaging Het
Mier2 A G 10: 79,380,991 (GRCm39) V231A probably benign Het
Muc5b A G 7: 141,422,144 (GRCm39) T4427A possibly damaging Het
Nox4 A G 7: 86,896,072 (GRCm39) S7G possibly damaging Het
Obscn G C 11: 58,971,143 (GRCm39) Q2457E probably damaging Het
Sh3bgrl2 C T 9: 83,459,684 (GRCm39) probably benign Het
Slc1a1 A G 19: 28,812,611 (GRCm39) probably benign Het
Snrnp40 C G 4: 130,271,836 (GRCm39) probably null Het
Stard9 C A 2: 120,504,117 (GRCm39) S221R probably damaging Het
Stat6 G C 10: 127,487,094 (GRCm39) R200S possibly damaging Het
Tanc1 A G 2: 59,673,835 (GRCm39) S1647G probably benign Het
Tmem132d T A 5: 127,861,923 (GRCm39) M733L probably benign Het
Unc13d A G 11: 115,964,381 (GRCm39) probably benign Het
Usp24 T C 4: 106,199,550 (GRCm39) S165P possibly damaging Het
Vmn1r9 T C 6: 57,048,615 (GRCm39) I230T probably damaging Het
Zscan20 T C 4: 128,481,889 (GRCm39) D591G possibly damaging Het
Other mutations in Stxbp5l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Stxbp5l APN 16 37,028,462 (GRCm39) missense possibly damaging 0.82
IGL01082:Stxbp5l APN 16 37,024,940 (GRCm39) missense possibly damaging 0.89
IGL01448:Stxbp5l APN 16 37,036,341 (GRCm39) missense probably damaging 0.99
IGL01475:Stxbp5l APN 16 37,165,454 (GRCm39) missense possibly damaging 0.95
IGL01899:Stxbp5l APN 16 37,020,954 (GRCm39) missense probably benign 0.19
IGL02232:Stxbp5l APN 16 37,150,257 (GRCm39) missense probably damaging 1.00
IGL02389:Stxbp5l APN 16 37,028,567 (GRCm39) missense probably benign 0.00
IGL02745:Stxbp5l APN 16 37,007,016 (GRCm39) nonsense probably null
IGL03125:Stxbp5l APN 16 37,007,083 (GRCm39) missense probably benign 0.02
R0058:Stxbp5l UTSW 16 36,962,736 (GRCm39) missense possibly damaging 0.76
R0345:Stxbp5l UTSW 16 37,108,670 (GRCm39) missense probably damaging 1.00
R0359:Stxbp5l UTSW 16 37,036,440 (GRCm39) splice site probably benign
R0454:Stxbp5l UTSW 16 36,954,646 (GRCm39) missense possibly damaging 0.94
R0525:Stxbp5l UTSW 16 36,950,159 (GRCm39) critical splice donor site probably null
R0543:Stxbp5l UTSW 16 37,028,458 (GRCm39) missense probably damaging 1.00
R0606:Stxbp5l UTSW 16 37,024,883 (GRCm39) missense possibly damaging 0.46
R0607:Stxbp5l UTSW 16 36,962,794 (GRCm39) missense probably benign 0.00
R1593:Stxbp5l UTSW 16 36,936,414 (GRCm39) missense probably damaging 0.96
R1605:Stxbp5l UTSW 16 37,028,473 (GRCm39) missense probably benign 0.34
R1670:Stxbp5l UTSW 16 37,111,289 (GRCm39) critical splice donor site probably null
R2077:Stxbp5l UTSW 16 37,056,637 (GRCm39) missense possibly damaging 0.93
R2209:Stxbp5l UTSW 16 37,036,398 (GRCm39) missense probably damaging 0.98
R2504:Stxbp5l UTSW 16 36,936,029 (GRCm39) missense probably damaging 1.00
R2909:Stxbp5l UTSW 16 37,028,548 (GRCm39) missense possibly damaging 0.89
R2917:Stxbp5l UTSW 16 37,021,004 (GRCm39) nonsense probably null
R2918:Stxbp5l UTSW 16 37,021,004 (GRCm39) nonsense probably null
R2935:Stxbp5l UTSW 16 36,954,551 (GRCm39) missense possibly damaging 0.76
R3693:Stxbp5l UTSW 16 37,061,708 (GRCm39) nonsense probably null
R3694:Stxbp5l UTSW 16 37,061,708 (GRCm39) nonsense probably null
R3695:Stxbp5l UTSW 16 37,061,708 (GRCm39) nonsense probably null
R4133:Stxbp5l UTSW 16 37,028,481 (GRCm39) missense possibly damaging 0.80
R4180:Stxbp5l UTSW 16 37,068,242 (GRCm39) missense probably benign 0.05
R4676:Stxbp5l UTSW 16 37,076,246 (GRCm39) missense probably damaging 1.00
R4757:Stxbp5l UTSW 16 37,008,996 (GRCm39) missense probably damaging 1.00
R4758:Stxbp5l UTSW 16 36,954,592 (GRCm39) missense probably benign 0.18
R5105:Stxbp5l UTSW 16 36,962,734 (GRCm39) missense probably benign 0.43
R5278:Stxbp5l UTSW 16 37,007,016 (GRCm39) missense probably benign 0.19
R5358:Stxbp5l UTSW 16 36,994,688 (GRCm39) missense probably damaging 0.99
R5411:Stxbp5l UTSW 16 36,950,213 (GRCm39) missense probably damaging 1.00
R5773:Stxbp5l UTSW 16 37,028,459 (GRCm39) missense probably damaging 1.00
R6539:Stxbp5l UTSW 16 36,950,177 (GRCm39) missense probably damaging 1.00
R6869:Stxbp5l UTSW 16 37,024,810 (GRCm39) missense possibly damaging 0.74
R6892:Stxbp5l UTSW 16 37,008,991 (GRCm39) missense possibly damaging 0.94
R7369:Stxbp5l UTSW 16 36,954,703 (GRCm39) missense probably benign 0.12
R7555:Stxbp5l UTSW 16 37,143,965 (GRCm39) missense probably damaging 1.00
R7657:Stxbp5l UTSW 16 37,030,534 (GRCm39) missense probably null 0.21
R8171:Stxbp5l UTSW 16 37,028,416 (GRCm39) missense noncoding transcript
R8338:Stxbp5l UTSW 16 36,994,718 (GRCm39) missense probably damaging 1.00
R8732:Stxbp5l UTSW 16 37,061,809 (GRCm39) missense probably benign
R8833:Stxbp5l UTSW 16 37,024,814 (GRCm39) missense probably benign 0.44
R8883:Stxbp5l UTSW 16 37,036,414 (GRCm39) frame shift probably null
R8898:Stxbp5l UTSW 16 37,036,414 (GRCm39) frame shift probably null
R8899:Stxbp5l UTSW 16 37,036,414 (GRCm39) frame shift probably null
R8906:Stxbp5l UTSW 16 37,028,526 (GRCm39) missense probably damaging 1.00
R8918:Stxbp5l UTSW 16 36,954,892 (GRCm39) missense
R8959:Stxbp5l UTSW 16 37,036,414 (GRCm39) frame shift probably null
R8961:Stxbp5l UTSW 16 37,036,414 (GRCm39) frame shift probably null
R8989:Stxbp5l UTSW 16 37,036,414 (GRCm39) frame shift probably null
R9027:Stxbp5l UTSW 16 37,165,473 (GRCm39) missense probably damaging 1.00
R9044:Stxbp5l UTSW 16 37,024,930 (GRCm39) missense possibly damaging 0.77
R9226:Stxbp5l UTSW 16 37,076,206 (GRCm39) missense probably damaging 0.96
R9284:Stxbp5l UTSW 16 37,028,442 (GRCm39) nonsense probably null
R9351:Stxbp5l UTSW 16 36,936,047 (GRCm39) missense probably damaging 1.00
R9425:Stxbp5l UTSW 16 36,994,706 (GRCm39) missense possibly damaging 0.83
R9545:Stxbp5l UTSW 16 37,028,625 (GRCm39) critical splice acceptor site probably null
R9567:Stxbp5l UTSW 16 37,061,734 (GRCm39) missense probably benign 0.37
R9616:Stxbp5l UTSW 16 37,036,314 (GRCm39) missense probably damaging 1.00
R9781:Stxbp5l UTSW 16 37,165,485 (GRCm39) missense probably benign 0.38
Z1088:Stxbp5l UTSW 16 37,024,851 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- caAGTCTCacagacacacacacaca -3'
(R):5'- GTGCAAGAAGCTACATGAATCATCCCTA -3'

Sequencing Primer
(F):5'- TCTCACAAGGAGTATCAACAGATG -3'
(R):5'- CATCCCTAGAAAATTGTA -3'
Posted On 2014-02-11