Incidental Mutation 'R1334:Ldah'
ID156821
Institutional Source Beutler Lab
Gene Symbol Ldah
Ensembl Gene ENSMUSG00000037669
Gene Namelipid droplet associated hydrolase
Synonyms1110057K04Rik
MMRRC Submission 039399-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1334 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location8208107-8285759 bp(+) (GRCm38)
Type of Mutationunclassified (10 bp from exon)
DNA Base Change (assembly) T to C at 8284089 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000037383] [ENSMUST00000169104] [ENSMUST00000218305] [ENSMUST00000219058]
Predicted Effect probably null
Transcript: ENSMUST00000037383
AA Change: *327Q
SMART Domains Protein: ENSMUSP00000042285
Gene: ENSMUSG00000037669
AA Change: *327Q

DomainStartEndE-ValueType
Pfam:DUF2305 43 304 5.2e-86 PFAM
Pfam:Abhydrolase_5 46 302 1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169104
SMART Domains Protein: ENSMUSP00000129424
Gene: ENSMUSG00000037669

DomainStartEndE-ValueType
Pfam:DUF2305 43 236 2.2e-59 PFAM
Pfam:Abhydrolase_6 47 209 2.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218305
Predicted Effect probably benign
Transcript: ENSMUST00000219058
Predicted Effect probably null
Transcript: ENSMUST00000219532
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal with no major alterations in energy balance, glucose homeostasis, cholesterol ester or triacylglycerol metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C T 2: 130,775,722 probably null Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Bnc2 T C 4: 84,276,289 E933G possibly damaging Het
Ccdc69 A T 11: 55,052,979 H75Q probably damaging Het
Ccdc81 C T 7: 89,866,561 E637K probably benign Het
Cpa3 T C 3: 20,222,223 E282G probably damaging Het
Cpxm1 G A 2: 130,393,563 P503L probably damaging Het
Dnah7b T C 1: 46,322,335 F3465S probably damaging Het
Dnaja3 T C 16: 4,699,794 S297P probably damaging Het
Enpp4 C A 17: 44,102,368 V92L probably benign Het
Fndc3b A T 3: 27,458,851 Y709N probably damaging Het
H2-Eb2 T G 17: 34,334,350 V170G probably damaging Het
Hmcn1 C T 1: 150,586,468 G5153D possibly damaging Het
Micu1 T C 10: 59,788,976 L280P probably damaging Het
Mon1a A C 9: 107,901,363 N262T probably damaging Het
Nim1k A G 13: 119,712,488 I290T probably benign Het
Olfr1109 T C 2: 87,093,227 T57A probably damaging Het
Olfr357 A T 2: 36,996,860 I17F probably benign Het
Olfr47 A G 6: 43,235,965 Y119C probably benign Het
Pcdhb12 C T 18: 37,436,671 T290I probably damaging Het
Pkhd1 T G 1: 20,533,905 D1187A possibly damaging Het
Primpol T C 8: 46,586,391 Y398C probably damaging Het
Prob1 T C 18: 35,653,252 T650A possibly damaging Het
Rasl12 G A 9: 65,410,869 V172M probably damaging Het
Rgs5 G A 1: 169,682,817 probably null Het
St14 T C 9: 31,108,210 Y105C probably damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Ttn T C 2: 76,745,043 T16842A probably damaging Het
Ttn T C 2: 76,812,972 E13201G probably damaging Het
Vwa5a C A 9: 38,734,741 N468K probably benign Het
Other mutations in Ldah
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01531:Ldah APN 12 8227337 missense probably benign 0.04
IGL01532:Ldah APN 12 8220596 splice site probably benign
IGL02554:Ldah APN 12 8283935 nonsense probably null
IGL02866:Ldah APN 12 8238602 missense probably benign 0.01
R0057:Ldah UTSW 12 8238432 intron probably benign
R4976:Ldah UTSW 12 8227237 missense probably benign 0.03
R5119:Ldah UTSW 12 8227237 missense probably benign 0.03
R5866:Ldah UTSW 12 8220614 missense possibly damaging 0.74
R6254:Ldah UTSW 12 8275912 unclassified probably benign
R6271:Ldah UTSW 12 8268599 critical splice donor site probably null
R8114:Ldah UTSW 12 8284039 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTAAAACTGATGGCTGGTGTCC -3'
(R):5'- TATCACGGCGATGGTCTCAGCAAG -3'

Sequencing Primer
(F):5'- CTGGTGTCCAGTAAAGTACTATGAAG -3'
(R):5'- GAAGTGATTTCCCCTCAACTAGG -3'
Posted On2014-02-11