Incidental Mutation 'R1334:Nim1k'
ID156823
Institutional Source Beutler Lab
Gene Symbol Nim1k
Ensembl Gene ENSMUSG00000095930
Gene NameNIM1 serine/threonine protein kinase
SynonymsE130304F04Rik, Nim1
MMRRC Submission 039399-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1334 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location119710094-119755882 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119712488 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 290 (I290T)
Ref Sequence ENSEMBL: ENSMUSP00000136377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178142] [ENSMUST00000179869] [ENSMUST00000224188]
Predicted Effect probably benign
Transcript: ENSMUST00000178142
AA Change: I290T

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000136377
Gene: ENSMUSG00000095930
AA Change: I290T

DomainStartEndE-ValueType
S_TKc 74 325 8.66e-92 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179869
SMART Domains Protein: ENSMUSP00000136944
Gene: ENSMUSG00000093930

DomainStartEndE-ValueType
Pfam:HMG_CoA_synt_N 13 186 4e-111 PFAM
Pfam:HMG_CoA_synt_C 187 469 4e-134 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224188
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C T 2: 130,775,722 probably null Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Bnc2 T C 4: 84,276,289 E933G possibly damaging Het
Ccdc69 A T 11: 55,052,979 H75Q probably damaging Het
Ccdc81 C T 7: 89,866,561 E637K probably benign Het
Cpa3 T C 3: 20,222,223 E282G probably damaging Het
Cpxm1 G A 2: 130,393,563 P503L probably damaging Het
Dnah7b T C 1: 46,322,335 F3465S probably damaging Het
Dnaja3 T C 16: 4,699,794 S297P probably damaging Het
Enpp4 C A 17: 44,102,368 V92L probably benign Het
Fndc3b A T 3: 27,458,851 Y709N probably damaging Het
H2-Eb2 T G 17: 34,334,350 V170G probably damaging Het
Hmcn1 C T 1: 150,586,468 G5153D possibly damaging Het
Ldah T C 12: 8,284,089 probably null Het
Micu1 T C 10: 59,788,976 L280P probably damaging Het
Mon1a A C 9: 107,901,363 N262T probably damaging Het
Olfr1109 T C 2: 87,093,227 T57A probably damaging Het
Olfr357 A T 2: 36,996,860 I17F probably benign Het
Olfr47 A G 6: 43,235,965 Y119C probably benign Het
Pcdhb12 C T 18: 37,436,671 T290I probably damaging Het
Pkhd1 T G 1: 20,533,905 D1187A possibly damaging Het
Primpol T C 8: 46,586,391 Y398C probably damaging Het
Prob1 T C 18: 35,653,252 T650A possibly damaging Het
Rasl12 G A 9: 65,410,869 V172M probably damaging Het
Rgs5 G A 1: 169,682,817 probably null Het
St14 T C 9: 31,108,210 Y105C probably damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Ttn T C 2: 76,745,043 T16842A probably damaging Het
Ttn T C 2: 76,812,972 E13201G probably damaging Het
Vwa5a C A 9: 38,734,741 N468K probably benign Het
Other mutations in Nim1k
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1782:Nim1k UTSW 13 119712151 missense probably benign 0.00
R2216:Nim1k UTSW 13 119714215 missense probably damaging 0.99
R3710:Nim1k UTSW 13 119712099 missense probably benign
R4385:Nim1k UTSW 13 119712626 missense probably damaging 0.98
R4430:Nim1k UTSW 13 119712542 missense possibly damaging 0.63
R4484:Nim1k UTSW 13 119712174 nonsense probably null
R4812:Nim1k UTSW 13 119712384 missense probably benign
R5383:Nim1k UTSW 13 119727799 missense probably benign 0.25
R5436:Nim1k UTSW 13 119727529 intron probably benign
R5511:Nim1k UTSW 13 119727594 missense probably damaging 1.00
R6682:Nim1k UTSW 13 119712188 missense probably benign 0.09
R6922:Nim1k UTSW 13 119727727 missense probably damaging 0.99
R7053:Nim1k UTSW 13 119727609 missense probably damaging 1.00
R7455:Nim1k UTSW 13 119712459 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGCAAGACACACCAGCTTTTAGG -3'
(R):5'- TACGCGGCACCAGAACTCTTTC -3'

Sequencing Primer
(F):5'- ATCCCCAAGTGTTCTAAAGTGC -3'
(R):5'- TTCATGGTGACTGGCACGAT -3'
Posted On2014-02-11