Incidental Mutation 'R1334:H2-Eb2'
ID 156825
Institutional Source Beutler Lab
Gene Symbol H2-Eb2
Ensembl Gene ENSMUSG00000067341
Gene Name histocompatibility 2, class II antigen E beta2
Synonyms A130038H09Rik, Ia5, H-2Eb2, Ia-5
MMRRC Submission 039399-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock # R1334 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 34325665-34340229 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 34334350 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 170 (V170G)
Ref Sequence ENSEMBL: ENSMUSP00000056814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050325]
AlphaFold Q3UUV9
Predicted Effect probably damaging
Transcript: ENSMUST00000050325
AA Change: V170G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000056814
Gene: ENSMUSG00000067341
AA Change: V170G

DomainStartEndE-ValueType
transmembrane domain 10 29 N/A INTRINSIC
MHC_II_beta 42 115 8.29e-35 SMART
IGc1 140 211 1.24e-26 SMART
transmembrane domain 227 249 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C T 2: 130,775,722 probably null Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Bnc2 T C 4: 84,276,289 E933G possibly damaging Het
Ccdc69 A T 11: 55,052,979 H75Q probably damaging Het
Ccdc81 C T 7: 89,866,561 E637K probably benign Het
Cpa3 T C 3: 20,222,223 E282G probably damaging Het
Cpxm1 G A 2: 130,393,563 P503L probably damaging Het
Dnah7b T C 1: 46,322,335 F3465S probably damaging Het
Dnaja3 T C 16: 4,699,794 S297P probably damaging Het
Enpp4 C A 17: 44,102,368 V92L probably benign Het
Fndc3b A T 3: 27,458,851 Y709N probably damaging Het
Hmcn1 C T 1: 150,586,468 G5153D possibly damaging Het
Ldah T C 12: 8,284,089 probably null Het
Micu1 T C 10: 59,788,976 L280P probably damaging Het
Mon1a A C 9: 107,901,363 N262T probably damaging Het
Nim1k A G 13: 119,712,488 I290T probably benign Het
Olfr1109 T C 2: 87,093,227 T57A probably damaging Het
Olfr357 A T 2: 36,996,860 I17F probably benign Het
Olfr47 A G 6: 43,235,965 Y119C probably benign Het
Pcdhb12 C T 18: 37,436,671 T290I probably damaging Het
Pkhd1 T G 1: 20,533,905 D1187A possibly damaging Het
Primpol T C 8: 46,586,391 Y398C probably damaging Het
Prob1 T C 18: 35,653,252 T650A possibly damaging Het
Rasl12 G A 9: 65,410,869 V172M probably damaging Het
Rgs5 G A 1: 169,682,817 probably null Het
St14 T C 9: 31,108,210 Y105C probably damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Ttn T C 2: 76,745,043 T16842A probably damaging Het
Ttn T C 2: 76,812,972 E13201G probably damaging Het
Vwa5a C A 9: 38,734,741 N468K probably benign Het
Other mutations in H2-Eb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:H2-Eb2 APN 17 34334367 missense probably damaging 0.98
IGL00965:H2-Eb2 APN 17 34325797 splice site probably null
IGL01380:H2-Eb2 APN 17 34335809 missense probably benign 0.41
IGL02057:H2-Eb2 APN 17 34335767 splice site probably benign
IGL02190:H2-Eb2 APN 17 34334374 missense probably damaging 1.00
IGL02220:H2-Eb2 APN 17 34325687 utr 5 prime probably benign
R0469:H2-Eb2 UTSW 17 34334244 nonsense probably null
R0510:H2-Eb2 UTSW 17 34334244 nonsense probably null
R1169:H2-Eb2 UTSW 17 34333357 missense possibly damaging 0.89
R1598:H2-Eb2 UTSW 17 34334374 missense probably damaging 1.00
R1991:H2-Eb2 UTSW 17 34334304 missense probably benign 0.15
R2103:H2-Eb2 UTSW 17 34334304 missense probably benign 0.15
R4191:H2-Eb2 UTSW 17 34344555 unclassified probably benign
R4194:H2-Eb2 UTSW 17 34333326 missense probably benign
R4461:H2-Eb2 UTSW 17 34333523 missense possibly damaging 0.80
R4774:H2-Eb2 UTSW 17 34334401 missense probably damaging 0.99
R4882:H2-Eb2 UTSW 17 34334256 missense probably benign
R5663:H2-Eb2 UTSW 17 34333408 missense possibly damaging 0.92
R6913:H2-Eb2 UTSW 17 34333549 missense possibly damaging 0.89
R7139:H2-Eb2 UTSW 17 34334421 missense probably benign 0.30
R7457:H2-Eb2 UTSW 17 34334347 missense probably damaging 1.00
R9173:H2-Eb2 UTSW 17 34333517 missense probably benign 0.37
Z1176:H2-Eb2 UTSW 17 34334309 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- TCAGACCCAACAGATCCTGCTGTC -3'
(R):5'- CAGAGTCAAGGGTTTCCCACTCAC -3'

Sequencing Primer
(F):5'- CCTACAGGGAGGACAGCTTTATC -3'
(R):5'- CTCCACTCCACTGTGACAGG -3'
Posted On 2014-02-11