Incidental Mutation 'R1336:Fcrl6'
ID156862
Institutional Source Beutler Lab
Gene Symbol Fcrl6
Ensembl Gene ENSMUSG00000070504
Gene NameFc receptor-like 6
SynonymsENSMUSG00000070504, mIFGP6, moFcRH6, FcRH6
MMRRC Submission 039401-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1336 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location172596642-172602551 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 172599224 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 52 (Q52*)
Ref Sequence ENSEMBL: ENSMUSP00000091861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094303]
Predicted Effect probably null
Transcript: ENSMUST00000094303
AA Change: Q52*
SMART Domains Protein: ENSMUSP00000091861
Gene: ENSMUSG00000070504
AA Change: Q52*

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Ig_3 19 91 1.2e-4 PFAM
Pfam:Ig_2 20 106 8e-9 PFAM
Pfam:Ig_3 113 187 1.9e-9 PFAM
transmembrane domain 215 237 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193431
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193566
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.1%
  • 10x: 92.3%
  • 20x: 80.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asah2 A G 19: 32,044,941 I231T probably damaging Het
Bbs7 A G 3: 36,604,444 I227T probably benign Het
Ccdc141 T C 2: 77,014,440 T1428A probably damaging Het
Chsy1 C A 7: 66,125,239 probably null Het
Cox16 T C 12: 81,472,290 D89G probably damaging Het
Dnah17 A G 11: 118,043,215 I3511T possibly damaging Het
Dpy19l4 A T 4: 11,276,901 Y333N probably damaging Het
Fgl2 T A 5: 21,373,183 L156Q possibly damaging Het
Fras1 A G 5: 96,707,308 D1892G probably benign Het
Ogfod1 T C 8: 94,058,099 C344R probably damaging Het
Papss2 T C 19: 32,638,315 V149A possibly damaging Het
Plekhm3 CCTGCTGCTGCTGCTGCTGCTGCTGC CCTGCTGCTGCTGCTGCTGCTGC 1: 64,937,781 probably benign Het
Pmfbp1 T G 8: 109,530,266 I534S probably damaging Het
Rif1 T A 2: 52,078,314 W170R probably benign Het
Ros1 G A 10: 52,168,662 T183I probably damaging Het
Snx4 T C 16: 33,280,680 I234T probably benign Het
Sptbn4 A G 7: 27,417,963 S454P probably damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Uck1 T C 2: 32,259,654 D71G probably damaging Het
Vcan C T 13: 89,693,055 E497K probably damaging Het
Other mutations in Fcrl6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00903:Fcrl6 APN 1 172599107 missense probably benign 0.08
IGL01074:Fcrl6 APN 1 172599113 missense possibly damaging 0.89
IGL02146:Fcrl6 APN 1 172598697 missense probably benign 0.01
IGL02277:Fcrl6 APN 1 172599119 missense probably damaging 1.00
IGL03162:Fcrl6 APN 1 172598253 missense probably damaging 1.00
IGL03303:Fcrl6 APN 1 172597688 missense probably damaging 0.99
K3955:Fcrl6 UTSW 1 172597684 missense probably benign 0.00
R0051:Fcrl6 UTSW 1 172598753 missense probably benign 0.24
R0051:Fcrl6 UTSW 1 172598753 missense probably benign 0.24
R2125:Fcrl6 UTSW 1 172599248 missense probably benign 0.41
R2126:Fcrl6 UTSW 1 172599248 missense probably benign 0.41
R5376:Fcrl6 UTSW 1 172599280 missense probably damaging 1.00
R5395:Fcrl6 UTSW 1 172598720 missense possibly damaging 0.55
R6314:Fcrl6 UTSW 1 172598619 splice site probably null
R7525:Fcrl6 UTSW 1 172597672 missense probably benign 0.25
R7690:Fcrl6 UTSW 1 172598656 missense probably damaging 0.97
U24488:Fcrl6 UTSW 1 172598870 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTTCATGTTGCAGAGTGAGCACAG -3'
(R):5'- TGCAGAAGATCAGTCCTCAGTCTCC -3'

Sequencing Primer
(F):5'- GCCTGATATCTGGACCCATTAGTAG -3'
(R):5'- CATGTCTCCCCAGAGTTGTT -3'
Posted On2014-02-11