Incidental Mutation 'R1336:Bbs7'
ID156867
Institutional Source Beutler Lab
Gene Symbol Bbs7
Ensembl Gene ENSMUSG00000037325
Gene NameBardet-Biedl syndrome 7 (human)
Synonyms8430406N16Rik
MMRRC Submission 039401-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1336 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location36573142-36613477 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36604444 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 227 (I227T)
Ref Sequence ENSEMBL: ENSMUSP00000103791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040148] [ENSMUST00000108155] [ENSMUST00000108156]
Predicted Effect probably benign
Transcript: ENSMUST00000040148
AA Change: I227T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000047273
Gene: ENSMUSG00000037325
AA Change: I227T

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
coiled coil region 330 365 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108155
AA Change: I227T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103790
Gene: ENSMUSG00000037325
AA Change: I227T

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
coiled coil region 330 365 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108156
AA Change: I227T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103791
Gene: ENSMUSG00000037325
AA Change: I227T

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
coiled coil region 330 365 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129671
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.1%
  • 10x: 92.3%
  • 20x: 80.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of eight proteins that form the BBSome complex containing BBS1, BBS2, BBS4, BBS5, BBS7, BBS8, BBS9 and BBIP10. The BBSome complex is believed to recruit Rab8(GTP) to the primary cilium and promote ciliogenesis. The BBSome complex assembly is mediated by a complex composed of three chaperonin-like BBS proteins (BBS6, BBS10, and BBS12) and CCT/TRiC family chaperonins. Mutations in this gene are implicated in Bardet-Biedl syndrome, a genetic disorder whose symptoms include obesity, retinal degeneration, polydactyly and nephropathy; however, mutations in this gene and the BBS8 gene are thought to play a minor role and mutations in chaperonin-like BBS genes are found to be a major contributor to disease development in a multiethnic Bardet-Biedl syndrome patient population. Two transcript variants encoding distinct isoforms have been identified for this gene.[provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial preweaning lethality, retinal degeneration, obesity, ventriculomegaly, abnormal brain ependyma motile cilium morphology, and male infertility characterized by abnormal sperm flagellar axoneme structures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asah2 A G 19: 32,044,941 I231T probably damaging Het
Ccdc141 T C 2: 77,014,440 T1428A probably damaging Het
Chsy1 C A 7: 66,125,239 probably null Het
Cox16 T C 12: 81,472,290 D89G probably damaging Het
Dnah17 A G 11: 118,043,215 I3511T possibly damaging Het
Dpy19l4 A T 4: 11,276,901 Y333N probably damaging Het
Fcrl6 G A 1: 172,599,224 Q52* probably null Het
Fgl2 T A 5: 21,373,183 L156Q possibly damaging Het
Fras1 A G 5: 96,707,308 D1892G probably benign Het
Ogfod1 T C 8: 94,058,099 C344R probably damaging Het
Papss2 T C 19: 32,638,315 V149A possibly damaging Het
Plekhm3 CCTGCTGCTGCTGCTGCTGCTGCTGC CCTGCTGCTGCTGCTGCTGCTGC 1: 64,937,781 probably benign Het
Pmfbp1 T G 8: 109,530,266 I534S probably damaging Het
Rif1 T A 2: 52,078,314 W170R probably benign Het
Ros1 G A 10: 52,168,662 T183I probably damaging Het
Snx4 T C 16: 33,280,680 I234T probably benign Het
Sptbn4 A G 7: 27,417,963 S454P probably damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Uck1 T C 2: 32,259,654 D71G probably damaging Het
Vcan C T 13: 89,693,055 E497K probably damaging Het
Other mutations in Bbs7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00791:Bbs7 APN 3 36575287 makesense probably null
IGL01533:Bbs7 APN 3 36610235 missense possibly damaging 0.66
IGL01559:Bbs7 APN 3 36594510 missense probably damaging 1.00
IGL01793:Bbs7 APN 3 36605682 critical splice donor site probably null
IGL01867:Bbs7 APN 3 36573547 missense probably benign 0.21
IGL01955:Bbs7 APN 3 36610322 missense probably benign 0.16
IGL02207:Bbs7 APN 3 36604490 missense probably benign 0.10
IGL02212:Bbs7 APN 3 36594409 missense probably benign
IGL02451:Bbs7 APN 3 36610592 missense possibly damaging 0.94
IGL03267:Bbs7 APN 3 36573505 missense probably damaging 1.00
R0010:Bbs7 UTSW 3 36607717 splice site probably null
R0243:Bbs7 UTSW 3 36605734 missense probably benign
R0326:Bbs7 UTSW 3 36592376 missense possibly damaging 0.46
R0372:Bbs7 UTSW 3 36602832 missense probably benign 0.00
R0398:Bbs7 UTSW 3 36590717 missense probably benign
R0453:Bbs7 UTSW 3 36607669 missense possibly damaging 0.79
R0485:Bbs7 UTSW 3 36602873 missense probably damaging 1.00
R0592:Bbs7 UTSW 3 36610297 missense probably benign 0.05
R0619:Bbs7 UTSW 3 36607576 missense probably benign 0.02
R0720:Bbs7 UTSW 3 36592423 missense probably damaging 1.00
R0963:Bbs7 UTSW 3 36613263 missense probably benign 0.22
R1177:Bbs7 UTSW 3 36610180 unclassified probably null
R1242:Bbs7 UTSW 3 36578427 missense probably damaging 1.00
R1401:Bbs7 UTSW 3 36573557 missense probably benign 0.09
R1564:Bbs7 UTSW 3 36575795 missense probably damaging 0.99
R2417:Bbs7 UTSW 3 36592397 missense probably damaging 1.00
R3736:Bbs7 UTSW 3 36607670 missense possibly damaging 0.87
R4282:Bbs7 UTSW 3 36573571 missense probably damaging 1.00
R5412:Bbs7 UTSW 3 36599373 missense probably benign
R5444:Bbs7 UTSW 3 36612050 missense possibly damaging 0.50
R5932:Bbs7 UTSW 3 36582698 missense probably benign 0.01
R6030:Bbs7 UTSW 3 36602911 missense probably damaging 0.98
R6030:Bbs7 UTSW 3 36602911 missense probably damaging 0.98
R6148:Bbs7 UTSW 3 36613266 missense probably damaging 1.00
R6173:Bbs7 UTSW 3 36592374 nonsense probably null
R6897:Bbs7 UTSW 3 36598311 missense probably benign 0.07
R6912:Bbs7 UTSW 3 36605704 missense probably benign 0.00
R7224:Bbs7 UTSW 3 36605728 missense possibly damaging 0.48
R7268:Bbs7 UTSW 3 36604426 missense probably benign
R7456:Bbs7 UTSW 3 36594378 missense probably damaging 0.99
R8013:Bbs7 UTSW 3 36594387 missense probably damaging 1.00
R8014:Bbs7 UTSW 3 36594387 missense probably damaging 1.00
R8182:Bbs7 UTSW 3 36610223 missense probably damaging 1.00
X0003:Bbs7 UTSW 3 36575845 nonsense probably null
Z1177:Bbs7 UTSW 3 36602920 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGTAAATCCCTAAGCTCGCTGTCTAA -3'
(R):5'- GCACCACCTCGAAGCAGAGGAATAATAA -3'

Sequencing Primer
(F):5'- CCTAAGCTCGCTGTCTAATAGAAC -3'
(R):5'- CTTCTGTTCGGCACATCAGA -3'
Posted On2014-02-11