Incidental Mutation 'R1336:Bbs7'
ID 156867
Institutional Source Beutler Lab
Gene Symbol Bbs7
Ensembl Gene ENSMUSG00000037325
Gene Name Bardet-Biedl syndrome 7
Synonyms 8430406N16Rik
MMRRC Submission 039401-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1336 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 36627291-36667626 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 36658593 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 227 (I227T)
Ref Sequence ENSEMBL: ENSMUSP00000103791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040148] [ENSMUST00000108155] [ENSMUST00000108156]
AlphaFold Q8K2G4
Predicted Effect probably benign
Transcript: ENSMUST00000040148
AA Change: I227T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000047273
Gene: ENSMUSG00000037325
AA Change: I227T

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
coiled coil region 330 365 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108155
AA Change: I227T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103790
Gene: ENSMUSG00000037325
AA Change: I227T

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
coiled coil region 330 365 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108156
AA Change: I227T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103791
Gene: ENSMUSG00000037325
AA Change: I227T

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
coiled coil region 330 365 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129671
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.1%
  • 10x: 92.3%
  • 20x: 80.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of eight proteins that form the BBSome complex containing BBS1, BBS2, BBS4, BBS5, BBS7, BBS8, BBS9 and BBIP10. The BBSome complex is believed to recruit Rab8(GTP) to the primary cilium and promote ciliogenesis. The BBSome complex assembly is mediated by a complex composed of three chaperonin-like BBS proteins (BBS6, BBS10, and BBS12) and CCT/TRiC family chaperonins. Mutations in this gene are implicated in Bardet-Biedl syndrome, a genetic disorder whose symptoms include obesity, retinal degeneration, polydactyly and nephropathy; however, mutations in this gene and the BBS8 gene are thought to play a minor role and mutations in chaperonin-like BBS genes are found to be a major contributor to disease development in a multiethnic Bardet-Biedl syndrome patient population. Two transcript variants encoding distinct isoforms have been identified for this gene.[provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial preweaning lethality, retinal degeneration, obesity, ventriculomegaly, abnormal brain ependyma motile cilium morphology, and male infertility characterized by abnormal sperm flagellar axoneme structures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asah2 A G 19: 32,022,341 (GRCm39) I231T probably damaging Het
Ccdc141 T C 2: 76,844,784 (GRCm39) T1428A probably damaging Het
Chsy1 C A 7: 65,774,987 (GRCm39) probably null Het
Cox16 T C 12: 81,519,064 (GRCm39) D89G probably damaging Het
Dnah17 A G 11: 117,934,041 (GRCm39) I3511T possibly damaging Het
Dpy19l4 A T 4: 11,276,901 (GRCm39) Y333N probably damaging Het
Fcrl6 G A 1: 172,426,791 (GRCm39) Q52* probably null Het
Fgl2 T A 5: 21,578,181 (GRCm39) L156Q possibly damaging Het
Fras1 A G 5: 96,855,167 (GRCm39) D1892G probably benign Het
Ogfod1 T C 8: 94,784,727 (GRCm39) C344R probably damaging Het
Papss2 T C 19: 32,615,715 (GRCm39) V149A possibly damaging Het
Plekhm3 CCTGCTGCTGCTGCTGCTGCTGCTGC CCTGCTGCTGCTGCTGCTGCTGC 1: 64,976,940 (GRCm39) probably benign Het
Pmfbp1 T G 8: 110,256,898 (GRCm39) I534S probably damaging Het
Rif1 T A 2: 51,968,326 (GRCm39) W170R probably benign Het
Ros1 G A 10: 52,044,758 (GRCm39) T183I probably damaging Het
Snx4 T C 16: 33,101,050 (GRCm39) I234T probably benign Het
Sptbn4 A G 7: 27,117,388 (GRCm39) S454P probably damaging Het
Stard9 C A 2: 120,504,117 (GRCm39) S221R probably damaging Het
Uck1 T C 2: 32,149,666 (GRCm39) D71G probably damaging Het
Vcan C T 13: 89,841,174 (GRCm39) E497K probably damaging Het
Other mutations in Bbs7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00791:Bbs7 APN 3 36,629,436 (GRCm39) makesense probably null
IGL01533:Bbs7 APN 3 36,664,384 (GRCm39) missense possibly damaging 0.66
IGL01559:Bbs7 APN 3 36,648,659 (GRCm39) missense probably damaging 1.00
IGL01793:Bbs7 APN 3 36,659,831 (GRCm39) critical splice donor site probably null
IGL01867:Bbs7 APN 3 36,627,696 (GRCm39) missense probably benign 0.21
IGL01955:Bbs7 APN 3 36,664,471 (GRCm39) missense probably benign 0.16
IGL02207:Bbs7 APN 3 36,658,639 (GRCm39) missense probably benign 0.10
IGL02212:Bbs7 APN 3 36,648,558 (GRCm39) missense probably benign
IGL02451:Bbs7 APN 3 36,664,741 (GRCm39) missense possibly damaging 0.94
IGL03267:Bbs7 APN 3 36,627,654 (GRCm39) missense probably damaging 1.00
R0010:Bbs7 UTSW 3 36,661,866 (GRCm39) splice site probably null
R0243:Bbs7 UTSW 3 36,659,883 (GRCm39) missense probably benign
R0326:Bbs7 UTSW 3 36,646,525 (GRCm39) missense possibly damaging 0.46
R0372:Bbs7 UTSW 3 36,656,981 (GRCm39) missense probably benign 0.00
R0398:Bbs7 UTSW 3 36,644,866 (GRCm39) missense probably benign
R0453:Bbs7 UTSW 3 36,661,818 (GRCm39) missense possibly damaging 0.79
R0485:Bbs7 UTSW 3 36,657,022 (GRCm39) missense probably damaging 1.00
R0592:Bbs7 UTSW 3 36,664,446 (GRCm39) missense probably benign 0.05
R0619:Bbs7 UTSW 3 36,661,725 (GRCm39) missense probably benign 0.02
R0720:Bbs7 UTSW 3 36,646,572 (GRCm39) missense probably damaging 1.00
R0963:Bbs7 UTSW 3 36,667,412 (GRCm39) missense probably benign 0.22
R1177:Bbs7 UTSW 3 36,664,329 (GRCm39) splice site probably null
R1242:Bbs7 UTSW 3 36,632,576 (GRCm39) missense probably damaging 1.00
R1401:Bbs7 UTSW 3 36,627,706 (GRCm39) missense probably benign 0.09
R1564:Bbs7 UTSW 3 36,629,944 (GRCm39) missense probably damaging 0.99
R2417:Bbs7 UTSW 3 36,646,546 (GRCm39) missense probably damaging 1.00
R3736:Bbs7 UTSW 3 36,661,819 (GRCm39) missense possibly damaging 0.87
R4282:Bbs7 UTSW 3 36,627,720 (GRCm39) missense probably damaging 1.00
R5412:Bbs7 UTSW 3 36,653,522 (GRCm39) missense probably benign
R5444:Bbs7 UTSW 3 36,666,199 (GRCm39) missense possibly damaging 0.50
R5932:Bbs7 UTSW 3 36,636,847 (GRCm39) missense probably benign 0.01
R6030:Bbs7 UTSW 3 36,657,060 (GRCm39) missense probably damaging 0.98
R6030:Bbs7 UTSW 3 36,657,060 (GRCm39) missense probably damaging 0.98
R6148:Bbs7 UTSW 3 36,667,415 (GRCm39) missense probably damaging 1.00
R6173:Bbs7 UTSW 3 36,646,523 (GRCm39) nonsense probably null
R6897:Bbs7 UTSW 3 36,652,460 (GRCm39) missense probably benign 0.07
R6912:Bbs7 UTSW 3 36,659,853 (GRCm39) missense probably benign 0.00
R7224:Bbs7 UTSW 3 36,659,877 (GRCm39) missense possibly damaging 0.48
R7268:Bbs7 UTSW 3 36,658,575 (GRCm39) missense probably benign
R7456:Bbs7 UTSW 3 36,648,527 (GRCm39) missense probably damaging 0.99
R7959:Bbs7 UTSW 3 36,657,085 (GRCm39) missense probably damaging 1.00
R8013:Bbs7 UTSW 3 36,648,536 (GRCm39) missense probably damaging 1.00
R8014:Bbs7 UTSW 3 36,648,536 (GRCm39) missense probably damaging 1.00
R8182:Bbs7 UTSW 3 36,664,372 (GRCm39) missense probably damaging 1.00
R8750:Bbs7 UTSW 3 36,661,744 (GRCm39) missense possibly damaging 0.95
R9040:Bbs7 UTSW 3 36,629,987 (GRCm39) missense probably benign 0.00
R9045:Bbs7 UTSW 3 36,666,184 (GRCm39) missense probably benign 0.00
R9729:Bbs7 UTSW 3 36,661,818 (GRCm39) missense probably damaging 1.00
R9798:Bbs7 UTSW 3 36,652,439 (GRCm39) missense probably benign 0.01
X0003:Bbs7 UTSW 3 36,629,994 (GRCm39) nonsense probably null
Z1177:Bbs7 UTSW 3 36,657,069 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGTAAATCCCTAAGCTCGCTGTCTAA -3'
(R):5'- GCACCACCTCGAAGCAGAGGAATAATAA -3'

Sequencing Primer
(F):5'- CCTAAGCTCGCTGTCTAATAGAAC -3'
(R):5'- CTTCTGTTCGGCACATCAGA -3'
Posted On 2014-02-11