Mutagenetix > Incidental Mutations

Incidental Mutation 'R1336:Fgl2'

156869

Institutional Source

Beutler Lab

Gene Symbol

Fgl2

Ensembl Gene

ENSMUSG00000039899

Gene Name

fibrinogen-like protein 2

Synonyms

MMRRC Submission

039401-MU

Accession Numbers

Genbank: NM_008013; MGI: 103266

Is this an essential gene?

Probably non essential (E-score: 0.201) question?

Stock #

R1336 (G1)

Quality Score

137

Status

Not validated

Chromosome

Chromosomal Location

21372642-21378374 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 21373183 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 156 (L156Q)

Ref Sequence

ENSEMBL: ENSMUSP00000046131 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030552] [ENSMUST00000035799] [ENSMUST00000115245]

Predicted Effect

probably benign
Transcript: ENSMUST00000030552

SMART Domains

Protein: ENSMUSP00000030552
Gene: ENSMUSG00000064280

Domain	Start	End	E-Value	Type
coiled coil region	1	33	N/A	INTRINSIC
low complexity region	120	130	N/A	INTRINSIC
coiled coil region	194	320	N/A	INTRINSIC
low complexity region	333	342	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000035799
AA Change: L156Q

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000046131
Gene: ENSMUSG00000039899
AA Change: L156Q

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	54	70	N/A	INTRINSIC
coiled coil region	71	158	N/A	INTRINSIC
FBG	201	428	1.6e-131	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000115245

SMART Domains

Protein: ENSMUSP00000110900
Gene: ENSMUSG00000064280

Domain	Start	End	E-Value	Type
coiled coil region	1	33	N/A	INTRINSIC
low complexity region	120	130	N/A	INTRINSIC
coiled coil region	194	320	N/A	INTRINSIC
low complexity region	333	342	N/A	INTRINSIC
coiled coil region	438	477	N/A	INTRINSIC
coiled coil region	549	595	N/A	INTRINSIC
coiled coil region	617	663	N/A	INTRINSIC
coiled coil region	690	720	N/A	INTRINSIC
coiled coil region	770	793	N/A	INTRINSIC

Coding Region Coverage

1x: 98.5%
3x: 97.1%
10x: 92.3%
20x: 80.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a secreted protein that is similar to the beta- and gamma-chains of fibrinogen. The carboxyl-terminus of the encoded protein consists of the fibrinogen-related domains (FRED). The encoded protein forms a tetrameric complex which is stabilized by interchain disulfide bonds. This protein may play a role in physiologic functions at mucosal sites. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice for one allele have unaltered type 1 immunity responses. Homozygous null mice for another allele show partial embryonic lethality, hemorrhage at implantation sites, decreased susceptibility to hepatitis virus infection and prolongedsurvival of heart grafts. [provided by MGI curators]

Allele List at MGI

All alleles(2) : Targeted, knock-out(1) Targeted, other(1)

Other mutations in this stock

Total: 20 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Asah2	A	G	19: 32,044,941	I231T	probably damaging	Het
Bbs7	A	G	3: 36,604,444	I227T	probably benign	Het
Ccdc141	T	C	2: 77,014,440	T1428A	probably damaging	Het
Chsy1	C	A	7: 66,125,239		probably null	Het
Cox16	T	C	12: 81,472,290	D89G	probably damaging	Het
Dnah17	A	G	11: 118,043,215	I3511T	possibly damaging	Het
Dpy19l4	A	T	4: 11,276,901	Y333N	probably damaging	Het
Fcrl6	G	A	1: 172,599,224	Q52*	probably null	Het
Fras1	A	G	5: 96,707,308	D1892G	probably benign	Het
Ogfod1	T	C	8: 94,058,099	C344R	probably damaging	Het
Papss2	T	C	19: 32,638,315	V149A	possibly damaging	Het
Plekhm3	CCTGCTGCTGCTGCTGCTGCTGCTGC	CCTGCTGCTGCTGCTGCTGCTGC	1: 64,937,781		probably benign	Het
Pmfbp1	T	G	8: 109,530,266	I534S	probably damaging	Het
Rif1	T	A	2: 52,078,314	W170R	probably benign	Het
Ros1	G	A	10: 52,168,662	T183I	probably damaging	Het
Snx4	T	C	16: 33,280,680	I234T	probably benign	Het
Sptbn4	A	G	7: 27,417,963	S454P	probably damaging	Het
Stard9	C	A	2: 120,673,636	S221R	probably damaging	Het
Uck1	T	C	2: 32,259,654	D71G	probably damaging	Het
Vcan	C	T	13: 89,693,055	E497K	probably damaging	Het

Other mutations in Fgl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01622:Fgl2	APN	5	21373177	missense	possibly damaging	0.57
IGL01623:Fgl2	APN	5	21373177	missense	possibly damaging	0.57
IGL02056:Fgl2	APN	5	21375545	missense	probably damaging	0.99
IGL03128:Fgl2	APN	5	21373293	missense	probably benign
A4554:Fgl2	UTSW	5	21372778	missense	probably benign	0.01
R0049:Fgl2	UTSW	5	21375663	missense	possibly damaging	0.95
R0049:Fgl2	UTSW	5	21375663	missense	possibly damaging	0.95
R0052:Fgl2	UTSW	5	21375349	missense	probably damaging	1.00
R0052:Fgl2	UTSW	5	21375349	missense	probably damaging	1.00
R0149:Fgl2	UTSW	5	21375785	missense	probably damaging	1.00
R0316:Fgl2	UTSW	5	21375523	missense	possibly damaging	0.82
R1703:Fgl2	UTSW	5	21372732	missense	possibly damaging	0.89
R1893:Fgl2	UTSW	5	21375671	missense	probably benign	0.01
R2371:Fgl2	UTSW	5	21375818	missense	probably damaging	1.00
R4803:Fgl2	UTSW	5	21375920	missense	probably benign	0.00
R5250:Fgl2	UTSW	5	21375523	missense	possibly damaging	0.82
R5422:Fgl2	UTSW	5	21375810	missense	probably damaging	1.00
R6759:Fgl2	UTSW	5	21373258	missense	probably benign	0.00
R7808:Fgl2	UTSW	5	21373231	missense	possibly damaging	0.53
R7812:Fgl2	UTSW	5	21372898	missense	probably benign	0.01
R7838:Fgl2	UTSW	5	21372754	missense	probably benign	0.01
R8177:Fgl2	UTSW	5	21373309	critical splice donor site	probably null
R8725:Fgl2	UTSW	5	21375679	nonsense	probably null
R8727:Fgl2	UTSW	5	21375679	nonsense	probably null
X0017:Fgl2	UTSW	5	21375652	missense	probably damaging	0.98
X0026:Fgl2	UTSW	5	21375713	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTCAAAGAAGTGCGGACCCTCAAG -3'
(R):5'- GCTCCCTCGGGTTAATGTTTATGGC -3'

Sequencing Primer
(F):5'- AATCCTGCCAGGACTGTAAGTTG -3'
(R):5'- GGCCACTATCTGGCTATACAG -3'

Posted On

2014-02-11