Incidental Mutation 'R1336:Fgl2'
ID156869
Institutional Source Beutler Lab
Gene Symbol Fgl2
Ensembl Gene ENSMUSG00000039899
Gene Namefibrinogen-like protein 2
Synonyms
MMRRC Submission 039401-MU
Accession Numbers

Genbank: NM_008013; MGI: 103266

Is this an essential gene? Probably non essential (E-score: 0.231) question?
Stock #R1336 (G1)
Quality Score137
Status Not validated
Chromosome5
Chromosomal Location21372642-21378374 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 21373183 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 156 (L156Q)
Ref Sequence ENSEMBL: ENSMUSP00000046131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030552] [ENSMUST00000035799] [ENSMUST00000115245]
Predicted Effect probably benign
Transcript: ENSMUST00000030552
SMART Domains Protein: ENSMUSP00000030552
Gene: ENSMUSG00000064280

DomainStartEndE-ValueType
coiled coil region 1 33 N/A INTRINSIC
low complexity region 120 130 N/A INTRINSIC
coiled coil region 194 320 N/A INTRINSIC
low complexity region 333 342 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000035799
AA Change: L156Q

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000046131
Gene: ENSMUSG00000039899
AA Change: L156Q

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 54 70 N/A INTRINSIC
coiled coil region 71 158 N/A INTRINSIC
FBG 201 428 1.6e-131 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115245
SMART Domains Protein: ENSMUSP00000110900
Gene: ENSMUSG00000064280

DomainStartEndE-ValueType
coiled coil region 1 33 N/A INTRINSIC
low complexity region 120 130 N/A INTRINSIC
coiled coil region 194 320 N/A INTRINSIC
low complexity region 333 342 N/A INTRINSIC
coiled coil region 438 477 N/A INTRINSIC
coiled coil region 549 595 N/A INTRINSIC
coiled coil region 617 663 N/A INTRINSIC
coiled coil region 690 720 N/A INTRINSIC
coiled coil region 770 793 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.1%
  • 10x: 92.3%
  • 20x: 80.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a secreted protein that is similar to the beta- and gamma-chains of fibrinogen. The carboxyl-terminus of the encoded protein consists of the fibrinogen-related domains (FRED). The encoded protein forms a tetrameric complex which is stabilized by interchain disulfide bonds. This protein may play a role in physiologic functions at mucosal sites. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice for one allele have unaltered type 1 immunity responses. Homozygous null mice for another allele show partial embryonic lethality, hemorrhage at implantation sites, decreased susceptibility to hepatitis virus infection and prolongedsurvival of heart grafts. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(1) Targeted, other(1)

Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asah2 A G 19: 32,044,941 I231T probably damaging Het
Bbs7 A G 3: 36,604,444 I227T probably benign Het
Ccdc141 T C 2: 77,014,440 T1428A probably damaging Het
Chsy1 C A 7: 66,125,239 probably null Het
Cox16 T C 12: 81,472,290 D89G probably damaging Het
Dnah17 A G 11: 118,043,215 I3511T possibly damaging Het
Dpy19l4 A T 4: 11,276,901 Y333N probably damaging Het
Fcrl6 G A 1: 172,599,224 Q52* probably null Het
Fras1 A G 5: 96,707,308 D1892G probably benign Het
Ogfod1 T C 8: 94,058,099 C344R probably damaging Het
Papss2 T C 19: 32,638,315 V149A possibly damaging Het
Plekhm3 CCTGCTGCTGCTGCTGCTGCTGCTGC CCTGCTGCTGCTGCTGCTGCTGC 1: 64,937,781 probably benign Het
Pmfbp1 T G 8: 109,530,266 I534S probably damaging Het
Rif1 T A 2: 52,078,314 W170R probably benign Het
Ros1 G A 10: 52,168,662 T183I probably damaging Het
Snx4 T C 16: 33,280,680 I234T probably benign Het
Sptbn4 A G 7: 27,417,963 S454P probably damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Uck1 T C 2: 32,259,654 D71G probably damaging Het
Vcan C T 13: 89,693,055 E497K probably damaging Het
Other mutations in Fgl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01622:Fgl2 APN 5 21373177 missense possibly damaging 0.57
IGL01623:Fgl2 APN 5 21373177 missense possibly damaging 0.57
IGL02056:Fgl2 APN 5 21375545 missense probably damaging 0.99
IGL03128:Fgl2 APN 5 21373293 missense probably benign
A4554:Fgl2 UTSW 5 21372778 missense probably benign 0.01
R0049:Fgl2 UTSW 5 21375663 missense possibly damaging 0.95
R0049:Fgl2 UTSW 5 21375663 missense possibly damaging 0.95
R0052:Fgl2 UTSW 5 21375349 missense probably damaging 1.00
R0052:Fgl2 UTSW 5 21375349 missense probably damaging 1.00
R0149:Fgl2 UTSW 5 21375785 missense probably damaging 1.00
R0316:Fgl2 UTSW 5 21375523 missense possibly damaging 0.82
R1703:Fgl2 UTSW 5 21372732 missense possibly damaging 0.89
R1893:Fgl2 UTSW 5 21375671 missense probably benign 0.01
R2371:Fgl2 UTSW 5 21375818 missense probably damaging 1.00
R4803:Fgl2 UTSW 5 21375920 missense probably benign 0.00
R5250:Fgl2 UTSW 5 21375523 missense possibly damaging 0.82
R5422:Fgl2 UTSW 5 21375810 missense probably damaging 1.00
R6759:Fgl2 UTSW 5 21373258 missense probably benign 0.00
R7808:Fgl2 UTSW 5 21373231 missense possibly damaging 0.53
R7812:Fgl2 UTSW 5 21372898 missense probably benign 0.01
X0017:Fgl2 UTSW 5 21375652 missense probably damaging 0.98
X0026:Fgl2 UTSW 5 21375713 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCAAAGAAGTGCGGACCCTCAAG -3'
(R):5'- GCTCCCTCGGGTTAATGTTTATGGC -3'

Sequencing Primer
(F):5'- AATCCTGCCAGGACTGTAAGTTG -3'
(R):5'- GGCCACTATCTGGCTATACAG -3'
Posted On2014-02-11