Incidental Mutation 'R1336:Snx4'
ID156885
Institutional Source Beutler Lab
Gene Symbol Snx4
Ensembl Gene ENSMUSG00000022808
Gene Namesorting nexin 4
Synonyms
MMRRC Submission 039401-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R1336 (G1)
Quality Score179
Status Not validated
Chromosome16
Chromosomal Location33251442-33300269 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33280680 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 234 (I234T)
Ref Sequence ENSEMBL: ENSMUSP00000156185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023502] [ENSMUST00000231389]
Predicted Effect probably benign
Transcript: ENSMUST00000023502
AA Change: I234T

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000023502
Gene: ENSMUSG00000022808
AA Change: I234T

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
PX 56 184 1.86e-34 SMART
low complexity region 237 248 N/A INTRINSIC
coiled coil region 369 399 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231389
AA Change: I234T

PolyPhen 2 Score 0.204 (Sensitivity: 0.92; Specificity: 0.88)
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.1%
  • 10x: 92.3%
  • 20x: 80.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. This protein associated with the long isoform of the leptin receptor and with receptor tyrosine kinases for platelet-derived growth factor, insulin, and epidermal growth factor in cell cultures, but its function is unknown. This protein may form oligomeric complexes with family members. Two transcript variants, one protein coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asah2 A G 19: 32,044,941 I231T probably damaging Het
Bbs7 A G 3: 36,604,444 I227T probably benign Het
Ccdc141 T C 2: 77,014,440 T1428A probably damaging Het
Chsy1 C A 7: 66,125,239 probably null Het
Cox16 T C 12: 81,472,290 D89G probably damaging Het
Dnah17 A G 11: 118,043,215 I3511T possibly damaging Het
Dpy19l4 A T 4: 11,276,901 Y333N probably damaging Het
Fcrl6 G A 1: 172,599,224 Q52* probably null Het
Fgl2 T A 5: 21,373,183 L156Q possibly damaging Het
Fras1 A G 5: 96,707,308 D1892G probably benign Het
Ogfod1 T C 8: 94,058,099 C344R probably damaging Het
Papss2 T C 19: 32,638,315 V149A possibly damaging Het
Plekhm3 CCTGCTGCTGCTGCTGCTGCTGCTGC CCTGCTGCTGCTGCTGCTGCTGC 1: 64,937,781 probably benign Het
Pmfbp1 T G 8: 109,530,266 I534S probably damaging Het
Rif1 T A 2: 52,078,314 W170R probably benign Het
Ros1 G A 10: 52,168,662 T183I probably damaging Het
Sptbn4 A G 7: 27,417,963 S454P probably damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Uck1 T C 2: 32,259,654 D71G probably damaging Het
Vcan C T 13: 89,693,055 E497K probably damaging Het
Other mutations in Snx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01506:Snx4 APN 16 33264254 splice site probably benign
IGL01831:Snx4 APN 16 33284422 nonsense probably null
IGL02069:Snx4 APN 16 33264355 missense probably damaging 1.00
IGL03204:Snx4 APN 16 33269669 missense probably benign 0.01
R1613:Snx4 UTSW 16 33286046 missense probably damaging 1.00
R1901:Snx4 UTSW 16 33284438 missense possibly damaging 0.95
R2177:Snx4 UTSW 16 33286058 splice site probably null
R3147:Snx4 UTSW 16 33287724 missense probably benign 0.08
R3148:Snx4 UTSW 16 33287724 missense probably benign 0.08
R4380:Snx4 UTSW 16 33264296 missense probably damaging 1.00
R4924:Snx4 UTSW 16 33294730 missense probably benign 0.04
R6889:Snx4 UTSW 16 33251470 missense possibly damaging 0.89
R6904:Snx4 UTSW 16 33294738 missense probably damaging 0.97
R7355:Snx4 UTSW 16 33266866 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTTGTAATGTTCAGGGACAGGATGTGA -3'
(R):5'- ACCATGACACACCAGGAAGAAAGTAATG -3'

Sequencing Primer
(F):5'- GGATGTGATTAGATAGAACGAGTTTC -3'
(R):5'- GAAAAGACTCCCATTTCTCTTACGAG -3'
Posted On2014-02-11