Incidental Mutation 'R1338:4932438A13Rik'
ID 156930
Institutional Source Beutler Lab
Gene Symbol 4932438A13Rik
Ensembl Gene ENSMUSG00000037270
Gene Name RIKEN cDNA 4932438A13 gene
Synonyms Tweek, FSA
MMRRC Submission 039403-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1338 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 36863104-37053033 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 37052535 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Tyrosine at position 5005 (H5005Y)
Ref Sequence ENSEMBL: ENSMUSP00000117808 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057272] [ENSMUST00000138950] [ENSMUST00000152564]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000057272
AA Change: H5005Y
SMART Domains Protein: ENSMUSP00000060199
Gene: ENSMUSG00000037270
AA Change: H5005Y

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
low complexity region 701 716 N/A INTRINSIC
low complexity region 767 779 N/A INTRINSIC
low complexity region 1127 1138 N/A INTRINSIC
low complexity region 1154 1166 N/A INTRINSIC
low complexity region 1226 1240 N/A INTRINSIC
low complexity region 1381 1402 N/A INTRINSIC
low complexity region 1541 1547 N/A INTRINSIC
low complexity region 1593 1607 N/A INTRINSIC
low complexity region 1810 1821 N/A INTRINSIC
low complexity region 1981 1995 N/A INTRINSIC
low complexity region 2182 2191 N/A INTRINSIC
low complexity region 2336 2349 N/A INTRINSIC
low complexity region 2614 2657 N/A INTRINSIC
low complexity region 3468 3480 N/A INTRINSIC
low complexity region 3717 3742 N/A INTRINSIC
low complexity region 3816 3837 N/A INTRINSIC
low complexity region 3919 3929 N/A INTRINSIC
low complexity region 3941 3948 N/A INTRINSIC
low complexity region 4024 4038 N/A INTRINSIC
low complexity region 4041 4049 N/A INTRINSIC
low complexity region 4117 4149 N/A INTRINSIC
low complexity region 4172 4185 N/A INTRINSIC
low complexity region 4359 4380 N/A INTRINSIC
FSA_C 4386 4990 N/A SMART
low complexity region 4993 5004 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126099
Predicted Effect unknown
Transcript: ENSMUST00000138950
AA Change: H1507Y
SMART Domains Protein: ENSMUSP00000118092
Gene: ENSMUSG00000037270
AA Change: H1507Y

DomainStartEndE-ValueType
low complexity region 254 279 N/A INTRINSIC
low complexity region 353 374 N/A INTRINSIC
low complexity region 526 540 N/A INTRINSIC
low complexity region 543 551 N/A INTRINSIC
low complexity region 619 651 N/A INTRINSIC
low complexity region 674 687 N/A INTRINSIC
low complexity region 861 882 N/A INTRINSIC
FSA_C 888 1492 N/A SMART
low complexity region 1495 1506 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139667
Predicted Effect unknown
Transcript: ENSMUST00000141740
AA Change: H1585Y
SMART Domains Protein: ENSMUSP00000117814
Gene: ENSMUSG00000037270
AA Change: H1585Y

DomainStartEndE-ValueType
low complexity region 28 40 N/A INTRINSIC
low complexity region 298 323 N/A INTRINSIC
low complexity region 397 418 N/A INTRINSIC
low complexity region 500 510 N/A INTRINSIC
low complexity region 522 529 N/A INTRINSIC
low complexity region 605 619 N/A INTRINSIC
low complexity region 622 630 N/A INTRINSIC
low complexity region 698 730 N/A INTRINSIC
low complexity region 753 766 N/A INTRINSIC
low complexity region 940 961 N/A INTRINSIC
FSA_C 967 1571 N/A SMART
low complexity region 1574 1585 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000146948
AA Change: H1710Y
SMART Domains Protein: ENSMUSP00000121356
Gene: ENSMUSG00000037270
AA Change: H1710Y

DomainStartEndE-ValueType
low complexity region 121 133 N/A INTRINSIC
low complexity region 167 177 N/A INTRINSIC
low complexity region 458 483 N/A INTRINSIC
low complexity region 557 578 N/A INTRINSIC
low complexity region 730 744 N/A INTRINSIC
low complexity region 747 755 N/A INTRINSIC
low complexity region 823 855 N/A INTRINSIC
low complexity region 878 891 N/A INTRINSIC
low complexity region 1065 1086 N/A INTRINSIC
FSA_C 1092 1696 N/A SMART
low complexity region 1699 1710 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000152564
AA Change: H5005Y
SMART Domains Protein: ENSMUSP00000117808
Gene: ENSMUSG00000037270
AA Change: H5005Y

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
low complexity region 701 716 N/A INTRINSIC
low complexity region 767 779 N/A INTRINSIC
low complexity region 1127 1138 N/A INTRINSIC
low complexity region 1154 1166 N/A INTRINSIC
low complexity region 1226 1240 N/A INTRINSIC
low complexity region 1381 1402 N/A INTRINSIC
low complexity region 1541 1547 N/A INTRINSIC
low complexity region 1593 1607 N/A INTRINSIC
low complexity region 1810 1821 N/A INTRINSIC
low complexity region 1981 1995 N/A INTRINSIC
low complexity region 2182 2191 N/A INTRINSIC
low complexity region 2336 2349 N/A INTRINSIC
low complexity region 2614 2657 N/A INTRINSIC
low complexity region 3468 3480 N/A INTRINSIC
low complexity region 3717 3742 N/A INTRINSIC
low complexity region 3816 3837 N/A INTRINSIC
low complexity region 3919 3929 N/A INTRINSIC
low complexity region 3941 3948 N/A INTRINSIC
low complexity region 4024 4038 N/A INTRINSIC
low complexity region 4041 4049 N/A INTRINSIC
low complexity region 4117 4149 N/A INTRINSIC
low complexity region 4172 4185 N/A INTRINSIC
low complexity region 4359 4380 N/A INTRINSIC
FSA_C 4386 4990 N/A SMART
low complexity region 4993 5004 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.7%
  • 20x: 88.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is located on the long arm of chromosome 4 in a region that is associated with susceptibility to celiac disease. The encoded protein is similar to a Chinese hamster protein that is associated with spermatocyte and adipocyte differentiation. The C-terminus of the protein is also similar to a Caenorhabditis elegans protein that plays a role in lipid storage. In mammals, this protein is thought to function in the regulation of epithelial growth and differentiation, and in tumor development. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap12 G T 10: 4,313,773 (GRCm38) V61F possibly damaging Het
Amph G A 13: 19,142,028 (GRCm38) V643M probably damaging Het
Ap4e1 T A 2: 127,046,909 (GRCm38) D459E probably damaging Het
Brdt C A 5: 107,350,188 (GRCm38) P243Q probably benign Het
C5ar1 A C 7: 16,248,335 (GRCm38) F253L probably damaging Het
Cep104 T G 4: 153,994,508 (GRCm38) V323G probably benign Het
Col11a1 A T 3: 114,216,995 (GRCm38) probably benign Het
Fat3 T A 9: 15,925,091 (GRCm38) Y4039F probably benign Het
Lmcd1 A C 6: 112,305,128 (GRCm38) H41P probably damaging Het
Olfr466 T C 13: 65,152,383 (GRCm38) L53P probably damaging Het
P2ry13 T C 3: 59,210,289 (GRCm38) T23A probably benign Het
Pcdhb14 A T 18: 37,449,890 (GRCm38) E683V probably benign Het
Pck1 G A 2: 173,158,410 (GRCm38) E545K probably benign Het
Pkhd1l1 T C 15: 44,526,724 (GRCm38) V1412A probably damaging Het
Rnf139 T C 15: 58,899,215 (GRCm38) V363A probably damaging Het
Serpinh1 A G 7: 99,348,911 (GRCm38) S171P probably damaging Het
Skint6 T C 4: 113,012,961 (GRCm38) K600R possibly damaging Het
Slc7a1 C T 5: 148,345,936 (GRCm38) E34K probably damaging Het
Spata31d1b AGGG AGG 13: 59,718,161 (GRCm38) probably null Het
Stard9 C A 2: 120,673,636 (GRCm38) S221R probably damaging Het
Ttc6 A T 12: 57,616,369 (GRCm38) N317I probably benign Het
Zan A T 5: 137,393,651 (GRCm38) C4627* probably null Het
Zfhx4 T C 3: 5,396,961 (GRCm38) V1232A possibly damaging Het
Other mutations in 4932438A13Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:4932438A13Rik APN 3 37,011,727 (GRCm38) missense probably benign 0.00
IGL00434:4932438A13Rik APN 3 36,987,299 (GRCm38) missense probably damaging 0.98
IGL00640:4932438A13Rik APN 3 36,908,218 (GRCm38) missense probably damaging 1.00
IGL00693:4932438A13Rik APN 3 37,052,547 (GRCm38) utr 3 prime probably benign
IGL00721:4932438A13Rik APN 3 37,030,751 (GRCm38) splice site probably null
IGL00756:4932438A13Rik APN 3 36,908,218 (GRCm38) missense probably damaging 1.00
IGL00896:4932438A13Rik APN 3 37,039,462 (GRCm38) missense probably benign
IGL00902:4932438A13Rik APN 3 37,041,345 (GRCm38) missense probably damaging 1.00
IGL00980:4932438A13Rik APN 3 37,000,041 (GRCm38) missense probably damaging 1.00
IGL01019:4932438A13Rik APN 3 37,006,984 (GRCm38) critical splice acceptor site probably null
IGL01025:4932438A13Rik APN 3 37,046,280 (GRCm38) missense possibly damaging 0.89
IGL01306:4932438A13Rik APN 3 37,005,013 (GRCm38) splice site probably benign
IGL01370:4932438A13Rik APN 3 36,947,755 (GRCm38) missense probably benign 0.07
IGL01377:4932438A13Rik APN 3 36,973,452 (GRCm38) critical splice donor site probably null
IGL01401:4932438A13Rik APN 3 36,942,292 (GRCm38) missense probably benign
IGL01419:4932438A13Rik APN 3 37,048,121 (GRCm38) missense probably damaging 1.00
IGL01432:4932438A13Rik APN 3 37,003,759 (GRCm38) missense possibly damaging 0.87
IGL01433:4932438A13Rik APN 3 36,887,770 (GRCm38) missense probably damaging 1.00
IGL01452:4932438A13Rik APN 3 36,996,308 (GRCm38) unclassified probably benign
IGL01520:4932438A13Rik APN 3 36,973,260 (GRCm38) nonsense probably null
IGL01524:4932438A13Rik APN 3 36,942,382 (GRCm38) missense possibly damaging 0.90
IGL01628:4932438A13Rik APN 3 37,008,485 (GRCm38) missense probably damaging 1.00
IGL01638:4932438A13Rik APN 3 36,974,311 (GRCm38) missense probably damaging 1.00
IGL01650:4932438A13Rik APN 3 36,992,673 (GRCm38) splice site probably benign
IGL01717:4932438A13Rik APN 3 37,034,736 (GRCm38) missense probably benign
IGL01767:4932438A13Rik APN 3 37,041,363 (GRCm38) missense probably benign 0.29
IGL01813:4932438A13Rik APN 3 36,928,520 (GRCm38) missense possibly damaging 0.90
IGL01998:4932438A13Rik APN 3 36,957,016 (GRCm38) missense possibly damaging 0.49
IGL02172:4932438A13Rik APN 3 37,004,873 (GRCm38) missense probably damaging 0.99
IGL02197:4932438A13Rik APN 3 36,906,735 (GRCm38) missense probably damaging 1.00
IGL02248:4932438A13Rik APN 3 36,969,290 (GRCm38) critical splice donor site probably null
IGL02273:4932438A13Rik APN 3 36,921,437 (GRCm38) splice site probably benign
IGL02403:4932438A13Rik APN 3 37,030,664 (GRCm38) missense probably benign
IGL02492:4932438A13Rik APN 3 37,048,113 (GRCm38) missense probably benign 0.04
IGL02517:4932438A13Rik APN 3 36,958,868 (GRCm38) missense probably damaging 1.00
IGL02519:4932438A13Rik APN 3 36,895,315 (GRCm38) missense probably damaging 1.00
IGL02586:4932438A13Rik APN 3 37,044,608 (GRCm38) nonsense probably null
IGL02620:4932438A13Rik APN 3 37,035,945 (GRCm38) missense possibly damaging 0.95
IGL02621:4932438A13Rik APN 3 37,041,484 (GRCm38) splice site probably benign
IGL02670:4932438A13Rik APN 3 36,967,305 (GRCm38) nonsense probably null
IGL02806:4932438A13Rik APN 3 36,946,494 (GRCm38) missense possibly damaging 0.95
IGL02985:4932438A13Rik APN 3 36,958,757 (GRCm38) missense probably damaging 0.99
IGL03004:4932438A13Rik APN 3 36,965,677 (GRCm38) splice site probably benign
IGL03037:4932438A13Rik APN 3 36,969,207 (GRCm38) missense probably benign 0.23
IGL03037:4932438A13Rik APN 3 36,969,208 (GRCm38) missense probably damaging 1.00
IGL03062:4932438A13Rik APN 3 37,038,517 (GRCm38) splice site probably benign
IGL03137:4932438A13Rik APN 3 37,034,602 (GRCm38) missense probably damaging 0.98
IGL03150:4932438A13Rik APN 3 36,948,066 (GRCm38) missense probably damaging 1.00
IGL03204:4932438A13Rik APN 3 37,050,934 (GRCm38) splice site probably benign
IGL03207:4932438A13Rik APN 3 36,949,996 (GRCm38) missense possibly damaging 0.73
IGL03256:4932438A13Rik APN 3 36,906,683 (GRCm38) splice site probably benign
IGL03264:4932438A13Rik APN 3 37,002,635 (GRCm38) missense probably damaging 1.00
IGL03265:4932438A13Rik APN 3 37,047,991 (GRCm38) missense probably benign 0.00
IGL03303:4932438A13Rik APN 3 36,870,077 (GRCm38) missense possibly damaging 0.90
admonished UTSW 3 36,948,304 (GRCm38) missense probably damaging 1.00
alerted UTSW 3 37,033,265 (GRCm38) missense possibly damaging 0.85
informed UTSW 3 36,965,849 (GRCm38) missense probably damaging 1.00
resolved UTSW 3 36,921,221 (GRCm38) missense possibly damaging 0.60
tipped UTSW 3 36,988,085 (GRCm38) missense possibly damaging 0.81
warned UTSW 3 36,965,621 (GRCm38) missense probably damaging 1.00
FR4340:4932438A13Rik UTSW 3 37,050,752 (GRCm38) critical splice acceptor site probably benign
FR4737:4932438A13Rik UTSW 3 37,050,754 (GRCm38) critical splice acceptor site probably benign
PIT4515001:4932438A13Rik UTSW 3 36,974,236 (GRCm38) missense probably damaging 1.00
R0035:4932438A13Rik UTSW 3 36,987,598 (GRCm38) nonsense probably null
R0047:4932438A13Rik UTSW 3 36,908,192 (GRCm38) missense possibly damaging 0.83
R0047:4932438A13Rik UTSW 3 36,908,192 (GRCm38) missense possibly damaging 0.83
R0068:4932438A13Rik UTSW 3 36,952,221 (GRCm38) missense probably benign 0.28
R0068:4932438A13Rik UTSW 3 36,952,221 (GRCm38) missense probably benign 0.28
R0092:4932438A13Rik UTSW 3 37,028,159 (GRCm38) missense probably benign 0.41
R0233:4932438A13Rik UTSW 3 36,948,563 (GRCm38) nonsense probably null
R0233:4932438A13Rik UTSW 3 36,948,563 (GRCm38) nonsense probably null
R0256:4932438A13Rik UTSW 3 36,917,773 (GRCm38) missense probably benign 0.01
R0277:4932438A13Rik UTSW 3 36,943,182 (GRCm38) nonsense probably null
R0321:4932438A13Rik UTSW 3 36,906,788 (GRCm38) splice site probably null
R0323:4932438A13Rik UTSW 3 36,943,182 (GRCm38) nonsense probably null
R0335:4932438A13Rik UTSW 3 36,969,152 (GRCm38) missense probably damaging 1.00
R0375:4932438A13Rik UTSW 3 37,046,252 (GRCm38) missense probably damaging 0.99
R0437:4932438A13Rik UTSW 3 36,989,804 (GRCm38) missense possibly damaging 0.81
R0445:4932438A13Rik UTSW 3 37,000,065 (GRCm38) missense probably damaging 0.99
R0496:4932438A13Rik UTSW 3 36,987,635 (GRCm38) missense probably damaging 1.00
R0531:4932438A13Rik UTSW 3 37,036,825 (GRCm38) missense probably damaging 1.00
R0543:4932438A13Rik UTSW 3 36,996,458 (GRCm38) missense probably benign 0.22
R0545:4932438A13Rik UTSW 3 36,987,690 (GRCm38) splice site probably benign
R0674:4932438A13Rik UTSW 3 37,044,626 (GRCm38) missense possibly damaging 0.86
R0745:4932438A13Rik UTSW 3 36,928,463 (GRCm38) missense probably damaging 1.00
R0755:4932438A13Rik UTSW 3 36,946,364 (GRCm38) missense probably damaging 1.00
R0785:4932438A13Rik UTSW 3 36,959,334 (GRCm38) splice site probably benign
R1056:4932438A13Rik UTSW 3 37,044,680 (GRCm38) missense probably benign 0.44
R1056:4932438A13Rik UTSW 3 36,983,453 (GRCm38) missense possibly damaging 0.69
R1080:4932438A13Rik UTSW 3 36,988,255 (GRCm38) missense probably damaging 1.00
R1103:4932438A13Rik UTSW 3 36,996,523 (GRCm38) missense probably benign
R1119:4932438A13Rik UTSW 3 36,987,045 (GRCm38) missense probably damaging 1.00
R1170:4932438A13Rik UTSW 3 37,044,631 (GRCm38) missense probably damaging 0.98
R1183:4932438A13Rik UTSW 3 36,895,303 (GRCm38) missense possibly damaging 0.51
R1186:4932438A13Rik UTSW 3 36,996,312 (GRCm38) unclassified probably benign
R1201:4932438A13Rik UTSW 3 36,948,375 (GRCm38) missense probably benign
R1219:4932438A13Rik UTSW 3 36,946,470 (GRCm38) nonsense probably null
R1270:4932438A13Rik UTSW 3 36,952,184 (GRCm38) missense probably damaging 1.00
R1273:4932438A13Rik UTSW 3 36,987,210 (GRCm38) missense probably damaging 1.00
R1364:4932438A13Rik UTSW 3 36,987,030 (GRCm38) missense probably damaging 1.00
R1437:4932438A13Rik UTSW 3 36,942,429 (GRCm38) missense possibly damaging 0.65
R1447:4932438A13Rik UTSW 3 36,965,586 (GRCm38) missense probably damaging 0.98
R1467:4932438A13Rik UTSW 3 37,035,945 (GRCm38) missense probably damaging 0.99
R1467:4932438A13Rik UTSW 3 37,035,945 (GRCm38) missense probably damaging 0.99
R1470:4932438A13Rik UTSW 3 36,998,331 (GRCm38) missense probably benign 0.31
R1470:4932438A13Rik UTSW 3 36,998,331 (GRCm38) missense probably benign 0.31
R1481:4932438A13Rik UTSW 3 37,008,434 (GRCm38) missense probably damaging 0.99
R1528:4932438A13Rik UTSW 3 37,052,535 (GRCm38) missense unknown
R1533:4932438A13Rik UTSW 3 37,041,375 (GRCm38) missense probably damaging 1.00
R1546:4932438A13Rik UTSW 3 36,870,056 (GRCm38) missense possibly damaging 0.64
R1606:4932438A13Rik UTSW 3 36,942,399 (GRCm38) missense probably damaging 1.00
R1638:4932438A13Rik UTSW 3 37,035,812 (GRCm38) nonsense probably null
R1772:4932438A13Rik UTSW 3 36,959,432 (GRCm38) missense probably damaging 1.00
R1896:4932438A13Rik UTSW 3 36,908,231 (GRCm38) nonsense probably null
R1919:4932438A13Rik UTSW 3 37,006,983 (GRCm38) critical splice acceptor site probably null
R1983:4932438A13Rik UTSW 3 36,887,865 (GRCm38) missense probably null 1.00
R1987:4932438A13Rik UTSW 3 36,953,985 (GRCm38) critical splice donor site probably null
R1992:4932438A13Rik UTSW 3 37,000,032 (GRCm38) missense probably benign 0.32
R1999:4932438A13Rik UTSW 3 36,908,211 (GRCm38) missense probably damaging 1.00
R2004:4932438A13Rik UTSW 3 36,895,378 (GRCm38) missense possibly damaging 0.77
R2010:4932438A13Rik UTSW 3 36,928,551 (GRCm38) missense probably benign 0.09
R2027:4932438A13Rik UTSW 3 37,047,961 (GRCm38) splice site probably benign
R2039:4932438A13Rik UTSW 3 37,003,878 (GRCm38) missense possibly damaging 0.66
R2054:4932438A13Rik UTSW 3 36,947,853 (GRCm38) missense probably benign 0.01
R2089:4932438A13Rik UTSW 3 36,988,256 (GRCm38) missense probably damaging 1.00
R2091:4932438A13Rik UTSW 3 36,988,256 (GRCm38) missense probably damaging 1.00
R2091:4932438A13Rik UTSW 3 36,988,256 (GRCm38) missense probably damaging 1.00
R2091:4932438A13Rik UTSW 3 36,953,970 (GRCm38) missense probably damaging 1.00
R2220:4932438A13Rik UTSW 3 36,875,530 (GRCm38) critical splice donor site probably null
R2374:4932438A13Rik UTSW 3 36,885,396 (GRCm38) missense probably benign 0.00
R2437:4932438A13Rik UTSW 3 36,958,685 (GRCm38) splice site probably null
R2860:4932438A13Rik UTSW 3 36,965,849 (GRCm38) missense probably damaging 1.00
R2861:4932438A13Rik UTSW 3 36,965,849 (GRCm38) missense probably damaging 1.00
R2909:4932438A13Rik UTSW 3 36,947,953 (GRCm38) missense probably damaging 1.00
R2925:4932438A13Rik UTSW 3 37,007,122 (GRCm38) missense probably damaging 0.99
R2940:4932438A13Rik UTSW 3 36,958,805 (GRCm38) missense probably damaging 1.00
R3015:4932438A13Rik UTSW 3 36,875,462 (GRCm38) missense probably damaging 1.00
R3086:4932438A13Rik UTSW 3 37,011,703 (GRCm38) missense possibly damaging 0.56
R3159:4932438A13Rik UTSW 3 36,959,415 (GRCm38) missense probably benign 0.17
R3440:4932438A13Rik UTSW 3 37,041,912 (GRCm38) nonsense probably null
R3703:4932438A13Rik UTSW 3 36,987,581 (GRCm38) missense probably damaging 1.00
R3705:4932438A13Rik UTSW 3 36,987,581 (GRCm38) missense probably damaging 1.00
R3795:4932438A13Rik UTSW 3 37,030,565 (GRCm38) missense probably benign 0.30
R3820:4932438A13Rik UTSW 3 37,040,434 (GRCm38) missense probably damaging 1.00
R3862:4932438A13Rik UTSW 3 36,885,398 (GRCm38) missense possibly damaging 0.73
R3944:4932438A13Rik UTSW 3 37,030,061 (GRCm38) missense possibly damaging 0.90
R4020:4932438A13Rik UTSW 3 37,012,575 (GRCm38) intron probably benign
R4091:4932438A13Rik UTSW 3 37,030,589 (GRCm38) missense probably benign 0.00
R4159:4932438A13Rik UTSW 3 36,931,083 (GRCm38) missense probably benign 0.00
R4231:4932438A13Rik UTSW 3 36,920,236 (GRCm38) missense probably benign 0.10
R4368:4932438A13Rik UTSW 3 36,988,147 (GRCm38) nonsense probably null
R4413:4932438A13Rik UTSW 3 36,958,681 (GRCm38) splice site probably null
R4475:4932438A13Rik UTSW 3 37,040,395 (GRCm38) missense probably damaging 1.00
R4488:4932438A13Rik UTSW 3 37,003,933 (GRCm38) missense probably null 0.93
R4489:4932438A13Rik UTSW 3 37,003,933 (GRCm38) missense probably null 0.93
R4516:4932438A13Rik UTSW 3 36,895,311 (GRCm38) missense possibly damaging 0.90
R4580:4932438A13Rik UTSW 3 37,030,025 (GRCm38) missense probably benign 0.02
R4672:4932438A13Rik UTSW 3 36,889,990 (GRCm38) makesense probably null
R4705:4932438A13Rik UTSW 3 37,041,889 (GRCm38) missense probably benign 0.03
R4735:4932438A13Rik UTSW 3 37,004,967 (GRCm38) missense possibly damaging 0.84
R4741:4932438A13Rik UTSW 3 36,942,375 (GRCm38) missense probably damaging 0.99
R4754:4932438A13Rik UTSW 3 37,022,466 (GRCm38) nonsense probably null
R4778:4932438A13Rik UTSW 3 36,937,065 (GRCm38) missense possibly damaging 0.90
R4833:4932438A13Rik UTSW 3 36,964,968 (GRCm38) missense probably damaging 0.96
R4896:4932438A13Rik UTSW 3 36,965,937 (GRCm38) missense probably damaging 1.00
R4910:4932438A13Rik UTSW 3 36,998,199 (GRCm38) missense probably damaging 1.00
R4922:4932438A13Rik UTSW 3 36,987,165 (GRCm38) missense probably damaging 1.00
R4941:4932438A13Rik UTSW 3 36,919,901 (GRCm38) missense probably benign 0.41
R4941:4932438A13Rik UTSW 3 36,917,702 (GRCm38) missense probably damaging 1.00
R4980:4932438A13Rik UTSW 3 36,943,312 (GRCm38) missense probably damaging 1.00
R5030:4932438A13Rik UTSW 3 36,943,399 (GRCm38) intron probably benign
R5049:4932438A13Rik UTSW 3 37,041,390 (GRCm38) missense probably damaging 1.00
R5049:4932438A13Rik UTSW 3 37,040,506 (GRCm38) intron probably benign
R5089:4932438A13Rik UTSW 3 36,987,502 (GRCm38) missense probably benign 0.02
R5092:4932438A13Rik UTSW 3 37,000,085 (GRCm38) missense probably benign 0.14
R5122:4932438A13Rik UTSW 3 37,034,757 (GRCm38) splice site probably null
R5210:4932438A13Rik UTSW 3 37,033,265 (GRCm38) missense possibly damaging 0.85
R5246:4932438A13Rik UTSW 3 37,048,050 (GRCm38) missense probably damaging 1.00
R5289:4932438A13Rik UTSW 3 37,000,109 (GRCm38) missense probably damaging 0.97
R5348:4932438A13Rik UTSW 3 37,048,146 (GRCm38) missense probably damaging 1.00
R5394:4932438A13Rik UTSW 3 36,917,668 (GRCm38) missense probably damaging 1.00
R5434:4932438A13Rik UTSW 3 36,875,516 (GRCm38) missense probably damaging 1.00
R5667:4932438A13Rik UTSW 3 36,917,677 (GRCm38) missense probably benign 0.00
R5686:4932438A13Rik UTSW 3 36,917,660 (GRCm38) missense probably benign 0.00
R5701:4932438A13Rik UTSW 3 36,921,360 (GRCm38) missense probably benign 0.10
R5778:4932438A13Rik UTSW 3 36,958,714 (GRCm38) missense probably damaging 1.00
R5787:4932438A13Rik UTSW 3 36,992,733 (GRCm38) splice site probably null
R5800:4932438A13Rik UTSW 3 37,052,443 (GRCm38) missense probably damaging 1.00
R5819:4932438A13Rik UTSW 3 37,048,600 (GRCm38) missense probably benign 0.12
R5820:4932438A13Rik UTSW 3 37,039,526 (GRCm38) missense probably benign 0.00
R5952:4932438A13Rik UTSW 3 36,965,621 (GRCm38) missense probably damaging 1.00
R5975:4932438A13Rik UTSW 3 36,969,221 (GRCm38) missense possibly damaging 0.64
R5996:4932438A13Rik UTSW 3 36,931,116 (GRCm38) missense probably benign 0.07
R6192:4932438A13Rik UTSW 3 36,988,169 (GRCm38) missense probably benign 0.00
R6225:4932438A13Rik UTSW 3 36,948,304 (GRCm38) missense probably damaging 1.00
R6234:4932438A13Rik UTSW 3 36,983,471 (GRCm38) missense probably benign 0.00
R6244:4932438A13Rik UTSW 3 36,956,999 (GRCm38) missense probably benign
R6263:4932438A13Rik UTSW 3 36,931,111 (GRCm38) missense probably benign 0.06
R6351:4932438A13Rik UTSW 3 36,908,228 (GRCm38) missense probably damaging 1.00
R6380:4932438A13Rik UTSW 3 37,033,307 (GRCm38) missense probably benign 0.19
R6468:4932438A13Rik UTSW 3 37,008,443 (GRCm38) missense probably damaging 1.00
R6759:4932438A13Rik UTSW 3 36,988,085 (GRCm38) missense possibly damaging 0.81
R6792:4932438A13Rik UTSW 3 37,011,566 (GRCm38) critical splice acceptor site probably null
R6809:4932438A13Rik UTSW 3 36,874,282 (GRCm38) missense probably damaging 0.98
R6841:4932438A13Rik UTSW 3 37,021,481 (GRCm38) missense probably damaging 1.00
R6959:4932438A13Rik UTSW 3 36,967,189 (GRCm38) missense probably damaging 1.00
R7102:4932438A13Rik UTSW 3 36,940,798 (GRCm38) missense probably damaging 0.99
R7188:4932438A13Rik UTSW 3 36,950,013 (GRCm38) missense probably benign 0.06
R7212:4932438A13Rik UTSW 3 37,048,009 (GRCm38) missense
R7425:4932438A13Rik UTSW 3 36,983,394 (GRCm38) missense probably benign 0.02
R7425:4932438A13Rik UTSW 3 36,948,341 (GRCm38) missense probably benign
R7451:4932438A13Rik UTSW 3 37,022,807 (GRCm38) splice site probably null
R7604:4932438A13Rik UTSW 3 36,949,843 (GRCm38) splice site probably null
R7622:4932438A13Rik UTSW 3 36,948,413 (GRCm38) nonsense probably null
R7671:4932438A13Rik UTSW 3 36,943,231 (GRCm38) missense probably damaging 0.99
R7699:4932438A13Rik UTSW 3 37,026,154 (GRCm38) missense probably benign 0.00
R7699:4932438A13Rik UTSW 3 36,974,172 (GRCm38) missense possibly damaging 0.67
R7700:4932438A13Rik UTSW 3 36,974,172 (GRCm38) missense possibly damaging 0.67
R7700:4932438A13Rik UTSW 3 37,026,154 (GRCm38) missense probably benign 0.00
R7748:4932438A13Rik UTSW 3 36,959,335 (GRCm38) critical splice acceptor site probably null
R7767:4932438A13Rik UTSW 3 36,920,287 (GRCm38) critical splice donor site probably null
R7787:4932438A13Rik UTSW 3 36,885,408 (GRCm38) missense probably damaging 1.00
R7830:4932438A13Rik UTSW 3 36,964,932 (GRCm38) frame shift probably null
R7849:4932438A13Rik UTSW 3 37,026,328 (GRCm38) missense
R7912:4932438A13Rik UTSW 3 37,007,069 (GRCm38) missense probably damaging 0.99
R7914:4932438A13Rik UTSW 3 36,946,283 (GRCm38) missense probably benign 0.13
R7945:4932438A13Rik UTSW 3 36,965,893 (GRCm38) missense probably benign 0.03
R8039:4932438A13Rik UTSW 3 36,943,214 (GRCm38) missense probably benign 0.12
R8101:4932438A13Rik UTSW 3 37,008,502 (GRCm38) missense probably damaging 1.00
R8143:4932438A13Rik UTSW 3 36,946,508 (GRCm38) critical splice donor site probably null
R8145:4932438A13Rik UTSW 3 36,998,267 (GRCm38) missense probably damaging 1.00
R8171:4932438A13Rik UTSW 3 36,975,713 (GRCm38) missense probably benign 0.00
R8210:4932438A13Rik UTSW 3 37,012,881 (GRCm38) missense
R8250:4932438A13Rik UTSW 3 36,917,662 (GRCm38) missense probably damaging 0.99
R8369:4932438A13Rik UTSW 3 37,011,603 (GRCm38) missense
R8478:4932438A13Rik UTSW 3 37,033,277 (GRCm38) missense possibly damaging 0.74
R8558:4932438A13Rik UTSW 3 37,048,601 (GRCm38) missense
R8688:4932438A13Rik UTSW 3 37,035,917 (GRCm38) missense
R8724:4932438A13Rik UTSW 3 36,890,893 (GRCm38) missense probably damaging 0.99
R8818:4932438A13Rik UTSW 3 36,996,548 (GRCm38) missense possibly damaging 0.60
R8869:4932438A13Rik UTSW 3 36,958,858 (GRCm38) missense probably damaging 0.99
R8887:4932438A13Rik UTSW 3 37,033,354 (GRCm38) missense possibly damaging 0.95
R8899:4932438A13Rik UTSW 3 36,988,280 (GRCm38) missense probably damaging 1.00
R8907:4932438A13Rik UTSW 3 36,948,146 (GRCm38) nonsense probably null
R8960:4932438A13Rik UTSW 3 37,012,983 (GRCm38) missense probably damaging 1.00
R8990:4932438A13Rik UTSW 3 36,921,221 (GRCm38) missense possibly damaging 0.60
R9021:4932438A13Rik UTSW 3 36,998,344 (GRCm38) missense probably benign 0.00
R9048:4932438A13Rik UTSW 3 37,011,777 (GRCm38) missense
R9100:4932438A13Rik UTSW 3 37,044,758 (GRCm38) missense
R9166:4932438A13Rik UTSW 3 36,987,367 (GRCm38) missense probably damaging 1.00
R9176:4932438A13Rik UTSW 3 36,956,703 (GRCm38) missense possibly damaging 0.82
R9202:4932438A13Rik UTSW 3 36,890,821 (GRCm38) missense probably benign
R9303:4932438A13Rik UTSW 3 37,044,820 (GRCm38) missense
R9305:4932438A13Rik UTSW 3 37,044,820 (GRCm38) missense
R9332:4932438A13Rik UTSW 3 37,050,840 (GRCm38) missense
R9362:4932438A13Rik UTSW 3 36,957,013 (GRCm38) missense probably benign
R9493:4932438A13Rik UTSW 3 37,011,736 (GRCm38) missense
R9534:4932438A13Rik UTSW 3 36,998,270 (GRCm38) missense probably benign 0.01
R9569:4932438A13Rik UTSW 3 37,012,621 (GRCm38) missense
R9593:4932438A13Rik UTSW 3 36,947,941 (GRCm38) missense probably damaging 1.00
R9600:4932438A13Rik UTSW 3 37,041,416 (GRCm38) nonsense probably null
R9733:4932438A13Rik UTSW 3 37,048,583 (GRCm38) missense
R9751:4932438A13Rik UTSW 3 37,011,740 (GRCm38) missense
RF013:4932438A13Rik UTSW 3 37,050,757 (GRCm38) critical splice acceptor site probably benign
RF015:4932438A13Rik UTSW 3 37,050,748 (GRCm38) critical splice acceptor site probably benign
RF021:4932438A13Rik UTSW 3 37,050,748 (GRCm38) critical splice acceptor site probably benign
RF023:4932438A13Rik UTSW 3 37,050,760 (GRCm38) critical splice acceptor site probably benign
RF034:4932438A13Rik UTSW 3 37,050,760 (GRCm38) critical splice acceptor site probably benign
RF035:4932438A13Rik UTSW 3 37,050,758 (GRCm38) critical splice acceptor site probably benign
RF055:4932438A13Rik UTSW 3 37,050,757 (GRCm38) critical splice acceptor site probably benign
X0050:4932438A13Rik UTSW 3 36,957,128 (GRCm38) missense probably damaging 1.00
Z1088:4932438A13Rik UTSW 3 36,987,567 (GRCm38) missense probably damaging 1.00
Z1177:4932438A13Rik UTSW 3 36,983,440 (GRCm38) missense possibly damaging 0.88
Z1177:4932438A13Rik UTSW 3 36,919,950 (GRCm38) missense probably benign
Z1177:4932438A13Rik UTSW 3 37,036,707 (GRCm38) missense
Predicted Primers PCR Primer
(F):5'- ATTGGGCTTTCACCATGCCAGGAC -3'
(R):5'- TCTCTGGGAACCTTTTCCCTGGAAC -3'

Sequencing Primer
(F):5'- GACTACTATTCCCAAATGGCTTCAG -3'
(R):5'- CAACTATGGACTGAAGCCGTTATTG -3'
Posted On 2014-02-11