Mutagenetix > Incidental Mutations

Incidental Mutation 'R1338:Brdt'

156934

Institutional Source

Beutler Lab

Gene Symbol

Brdt

Ensembl Gene

ENSMUSG00000029279

Gene Name

bromodomain, testis-specific

Synonyms

Fsrg3, 7420412D09Rik, Brd6

MMRRC Submission

039403-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1338 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

107331159-107387058 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 107350188 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Glutamine at position 243 (P243Q)

Ref Sequence

ENSEMBL: ENSMUSP00000108297 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031215] [ENSMUST00000112677]

Predicted Effect

probably benign
Transcript: ENSMUST00000031215
AA Change: P243Q

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000031215
Gene: ENSMUSG00000029279
AA Change: P243Q

Domain	Start	End	E-Value	Type
BROMO	24	134	2.7e-45	SMART
BROMO	268	377	2.18e-40	SMART
low complexity region	392	417	N/A	INTRINSIC
low complexity region	446	455	N/A	INTRINSIC
low complexity region	472	500	N/A	INTRINSIC
Pfam:BET	505	569	9.2e-34	PFAM
low complexity region	585	603	N/A	INTRINSIC
low complexity region	649	691	N/A	INTRINSIC
low complexity region	895	909	N/A	INTRINSIC
Pfam:BRD4_CDT	913	956	3e-26	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000112677
AA Change: P243Q

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000108297
Gene: ENSMUSG00000029279
AA Change: P243Q

Domain	Start	End	E-Value	Type
BROMO	24	134	2.7e-45	SMART
Pfam:Bromodomain	275	326	2.7e-8	PFAM

Coding Region Coverage

1x: 98.8%
3x: 97.7%
10x: 94.7%
20x: 88.5%

Validation Efficiency

MGI Phenotype

FUNCTION: The protein encoded by this gene belongs to the BET protein family. BET proteins have two N-terminal bromodomains and one C-terminal extraterminal domain (ET domain). BET proteins regulate chromatin reorganization via binding to acetylated histones. This gene is thought to play a role in the transcriptional regulation of spermatogenesis. Although referred to as testis-specific bromodomain (Brdt) protein, RT-PCR indicates that this gene is expressed in both mouse oocytes and testes. Alternative splicing results in multiple transcript variants encoding different proteins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this genes leads to arrest of spermatogenesis and male infertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 23 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	C	T	3: 37,052,535	H5005Y	unknown	Het
Akap12	G	T	10: 4,313,773	V61F	possibly damaging	Het
Amph	G	A	13: 19,142,028	V643M	probably damaging	Het
Ap4e1	T	A	2: 127,046,909	D459E	probably damaging	Het
C5ar1	A	C	7: 16,248,335	F253L	probably damaging	Het
Cep104	T	G	4: 153,994,508	V323G	probably benign	Het
Col11a1	A	T	3: 114,216,995		probably benign	Het
Fat3	T	A	9: 15,925,091	Y4039F	probably benign	Het
Lmcd1	A	C	6: 112,305,128	H41P	probably damaging	Het
Olfr466	T	C	13: 65,152,383	L53P	probably damaging	Het
P2ry13	T	C	3: 59,210,289	T23A	probably benign	Het
Pcdhb14	A	T	18: 37,449,890	E683V	probably benign	Het
Pck1	G	A	2: 173,158,410	E545K	probably benign	Het
Pkhd1l1	T	C	15: 44,526,724	V1412A	probably damaging	Het
Rnf139	T	C	15: 58,899,215	V363A	probably damaging	Het
Serpinh1	A	G	7: 99,348,911	S171P	probably damaging	Het
Skint6	T	C	4: 113,012,961	K600R	possibly damaging	Het
Slc7a1	C	T	5: 148,345,936	E34K	probably damaging	Het
Spata31d1b	AGGG	AGG	13: 59,718,161		probably null	Het
Stard9	C	A	2: 120,673,636	S221R	probably damaging	Het
Ttc6	A	T	12: 57,616,369	N317I	probably benign	Het
Zan	A	T	5: 137,393,651	C4627*	probably null	Het
Zfhx4	T	C	3: 5,396,961	V1232A	possibly damaging	Het

Other mutations in Brdt

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02342:Brdt	APN	5	107342203	missense	probably damaging	1.00
IGL02718:Brdt	APN	5	107350068	splice site	probably benign
IGL02746:Brdt	APN	5	107370324	missense	probably benign
IGL02851:Brdt	APN	5	107377995	missense	possibly damaging	0.47
R0585:Brdt	UTSW	5	107356882	critical splice donor site	probably null
R0708:Brdt	UTSW	5	107358900	nonsense	probably null
R1710:Brdt	UTSW	5	107343584	missense	probably damaging	1.00
R1794:Brdt	UTSW	5	107359853	small deletion	probably benign
R1861:Brdt	UTSW	5	107359458	missense	probably benign
R1913:Brdt	UTSW	5	107348613	missense	probably benign
R2029:Brdt	UTSW	5	107359224	missense	probably benign	0.35
R2431:Brdt	UTSW	5	107378015	synonymous	probably null
R3121:Brdt	UTSW	5	107377145	missense	probably damaging	0.99
R3122:Brdt	UTSW	5	107377145	missense	probably damaging	0.99
R4258:Brdt	UTSW	5	107359909	missense	probably damaging	0.97
R4609:Brdt	UTSW	5	107359936	missense	probably benign	0.00
R5306:Brdt	UTSW	5	107345144	missense	probably damaging	1.00
R5640:Brdt	UTSW	5	107359308	nonsense	probably null
R5677:Brdt	UTSW	5	107348617	missense	possibly damaging	0.85
R5936:Brdt	UTSW	5	107359395	missense	probably damaging	1.00
R6145:Brdt	UTSW	5	107377999	missense	possibly damaging	0.67
R6261:Brdt	UTSW	5	107348503	missense	probably benign	0.04
R6408:Brdt	UTSW	5	107385492	missense	probably damaging	1.00
R6930:Brdt	UTSW	5	107359215	missense	probably benign	0.35
R7372:Brdt	UTSW	5	107370294	missense	possibly damaging	0.49
R7741:Brdt	UTSW	5	107358886	missense	probably benign	0.00
R7842:Brdt	UTSW	5	107348588	missense	possibly damaging	0.49
R7869:Brdt	UTSW	5	107370179	missense	probably benign	0.04
R7887:Brdt	UTSW	5	107359933	missense	possibly damaging	0.66
R7925:Brdt	UTSW	5	107348588	missense	possibly damaging	0.49
R7952:Brdt	UTSW	5	107370179	missense	probably benign	0.04
R8064:Brdt	UTSW	5	107377996	nonsense	probably null
X0011:Brdt	UTSW	5	107342128	missense	probably damaging	0.96
X0011:Brdt	UTSW	5	107377092	missense	probably damaging	1.00
Z1176:Brdt	UTSW	5	107359898	missense	possibly damaging	0.70

Predicted Primers

PCR Primer
(F):5'- ATTATGGGCCATGCCACCACAC -3'
(R):5'- GGCCATGCATACGGCAAATGTTTC -3'

Sequencing Primer
(F):5'- ACCACACCTGGCATCTATAGTTTG -3'
(R):5'- CATACGGCAAATGTTTCTTGGC -3'

Posted On

2014-02-11