Incidental Mutation 'R1339:Ifi208'
ID156953
Institutional Source Beutler Lab
Gene Symbol Ifi208
Ensembl Gene ENSMUSG00000066677
Gene Nameinterferon activated gene 208
SynonymsPydc3, E430029J22Rik, Pyr-rv1
MMRRC Submission 039404-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1339 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location173673675-173698395 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 173683238 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 320 (T320P)
Ref Sequence ENSEMBL: ENSMUSP00000128958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085876] [ENSMUST00000169857]
Predicted Effect probably damaging
Transcript: ENSMUST00000085876
AA Change: T320P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000083039
Gene: ENSMUSG00000066677
AA Change: T320P

DomainStartEndE-ValueType
PYRIN 10 88 3.23e-20 SMART
low complexity region 101 112 N/A INTRINSIC
low complexity region 211 222 N/A INTRINSIC
low complexity region 488 504 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169857
AA Change: T320P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128958
Gene: ENSMUSG00000066677
AA Change: T320P

DomainStartEndE-ValueType
PYRIN 10 88 3.23e-20 SMART
low complexity region 101 112 N/A INTRINSIC
low complexity region 211 222 N/A INTRINSIC
Pfam:HERV-K_REC 502 580 3.5e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182880
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik GCC GC 13: 59,691,598 probably null Het
Adamts20 A T 15: 94,322,896 N1385K probably benign Het
Cyp4a32 A G 4: 115,611,563 Y382C probably damaging Het
Dtnbp1 G A 13: 44,923,220 S237L probably damaging Het
Foxi1 T C 11: 34,205,866 T255A probably benign Het
Gm15448 A G 7: 3,822,156 Y496H probably damaging Het
Inhbc C A 10: 127,357,641 V169L probably benign Het
Irf7 G A 7: 141,263,704 R320C probably damaging Het
March6 T C 15: 31,486,402 T336A probably benign Het
Masp1 C A 16: 23,452,467 C677F probably damaging Het
Mei1 A G 15: 82,081,995 R323G possibly damaging Het
Olfr13 G C 6: 43,174,610 G208A probably benign Het
Olfr421-ps1 G T 1: 174,152,211 G232C probably damaging Het
Rel C T 11: 23,745,763 C208Y probably damaging Het
Rsg1 A G 4: 141,218,548 E134G probably damaging Het
Shc2 T G 10: 79,626,416 T298P probably benign Het
Syne1 G A 10: 5,367,571 L508F probably damaging Het
Ubn1 A G 16: 5,055,335 K74E probably damaging Het
Other mutations in Ifi208
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Ifi208 APN 1 173679038 critical splice donor site probably null
IGL00725:Ifi208 APN 1 173682861 missense possibly damaging 0.86
IGL01952:Ifi208 APN 1 173679031 missense possibly damaging 0.93
IGL02024:Ifi208 APN 1 173683290 missense probably damaging 0.99
IGL02637:Ifi208 APN 1 173678942 missense probably benign 0.15
IGL02829:Ifi208 APN 1 173682840 missense probably damaging 0.99
IGL03216:Ifi208 APN 1 173678941 missense possibly damaging 0.68
IGL03398:Ifi208 APN 1 173683251 missense probably damaging 0.96
FR4304:Ifi208 UTSW 1 173677698 small deletion probably benign
FR4340:Ifi208 UTSW 1 173677698 small deletion probably benign
FR4342:Ifi208 UTSW 1 173677698 small deletion probably benign
R0022:Ifi208 UTSW 1 173683046 missense possibly damaging 0.91
R0468:Ifi208 UTSW 1 173683481 missense probably benign 0.08
R0734:Ifi208 UTSW 1 173683335 missense probably damaging 0.98
R0780:Ifi208 UTSW 1 173682696 missense probably benign 0.06
R1070:Ifi208 UTSW 1 173683044 missense probably damaging 0.99
R1473:Ifi208 UTSW 1 173695654 missense possibly damaging 0.53
R1755:Ifi208 UTSW 1 173677910 missense possibly damaging 0.86
R3012:Ifi208 UTSW 1 173695570 critical splice acceptor site probably null
R3692:Ifi208 UTSW 1 173682872 missense possibly damaging 0.93
R4175:Ifi208 UTSW 1 173682701 missense probably benign 0.01
R4235:Ifi208 UTSW 1 173682911 missense probably benign 0.06
R4749:Ifi208 UTSW 1 173695614 missense possibly damaging 0.70
R4815:Ifi208 UTSW 1 173682837 missense probably damaging 0.96
R5116:Ifi208 UTSW 1 173677983 intron probably benign
R5138:Ifi208 UTSW 1 173690673 missense probably null 0.29
R5210:Ifi208 UTSW 1 173683265 missense probably benign
R5304:Ifi208 UTSW 1 173683608 missense probably benign
R6126:Ifi208 UTSW 1 173677708 missense possibly damaging 0.91
R6558:Ifi208 UTSW 1 173683023 missense probably damaging 0.99
R6915:Ifi208 UTSW 1 173682878 missense probably damaging 1.00
R7513:Ifi208 UTSW 1 173695654 nonsense probably null
R7972:Ifi208 UTSW 1 173678990 missense possibly damaging 0.68
R8143:Ifi208 UTSW 1 173682676 missense possibly damaging 0.91
R8383:Ifi208 UTSW 1 173683509 missense possibly damaging 0.93
R8431:Ifi208 UTSW 1 173683278 missense possibly damaging 0.85
RF027:Ifi208 UTSW 1 173677696 small deletion probably benign
RF029:Ifi208 UTSW 1 173677696 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- TTCCACCTGTGACAAATCTTCTCGG -3'
(R):5'- AAGGGCTGGATACTGTTGCTGC -3'

Sequencing Primer
(F):5'- CAGTGACAGTCTCCAGCAG -3'
(R):5'- GCAGATACATGAGGACTATTACAAC -3'
Posted On2014-02-11