Incidental Mutation 'R1339:Rsg1'
ID156956
Institutional Source Beutler Lab
Gene Symbol Rsg1
Ensembl Gene ENSMUSG00000073733
Gene NameREM2 and RAB-like small GTPase 1
SynonymsLOC279260, 6330545A04Rik
MMRRC Submission 039404-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.232) question?
Stock #R1339 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location141213956-141226756 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 141218548 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 134 (E134G)
Ref Sequence ENSEMBL: ENSMUSP00000095422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097813]
Predicted Effect probably damaging
Transcript: ENSMUST00000097813
AA Change: E134G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095422
Gene: ENSMUSG00000073733
AA Change: E134G

DomainStartEndE-ValueType
Pfam:Roc 57 179 7.3e-9 PFAM
Pfam:Ras 57 207 4.3e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125175
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151475
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for ENU-induced mutations exhibit cardiovascular defects including persistent truncus arteriosus and atrioventricular septal defects, as well as polydactyly and micrognathia. Eye defects, hypoplastic lungs and thymus, and tracheoesophageal anomalies may be also present. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik GCC GC 13: 59,691,598 probably null Het
Adamts20 A T 15: 94,322,896 N1385K probably benign Het
Cyp4a32 A G 4: 115,611,563 Y382C probably damaging Het
Dtnbp1 G A 13: 44,923,220 S237L probably damaging Het
Foxi1 T C 11: 34,205,866 T255A probably benign Het
Gm15448 A G 7: 3,822,156 Y496H probably damaging Het
Ifi208 A C 1: 173,683,238 T320P probably damaging Het
Inhbc C A 10: 127,357,641 V169L probably benign Het
Irf7 G A 7: 141,263,704 R320C probably damaging Het
March6 T C 15: 31,486,402 T336A probably benign Het
Masp1 C A 16: 23,452,467 C677F probably damaging Het
Mei1 A G 15: 82,081,995 R323G possibly damaging Het
Olfr13 G C 6: 43,174,610 G208A probably benign Het
Olfr421-ps1 G T 1: 174,152,211 G232C probably damaging Het
Rel C T 11: 23,745,763 C208Y probably damaging Het
Shc2 T G 10: 79,626,416 T298P probably benign Het
Syne1 G A 10: 5,367,571 L508F probably damaging Het
Ubn1 A G 16: 5,055,335 K74E probably damaging Het
Other mutations in Rsg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01434:Rsg1 APN 4 141218653 missense probably benign 0.01
R0488:Rsg1 UTSW 4 141214401 missense probably benign 0.05
R0967:Rsg1 UTSW 4 141219851 missense probably benign 0.01
R1460:Rsg1 UTSW 4 141218212 missense probably damaging 0.97
R3826:Rsg1 UTSW 4 141218589 missense probably damaging 1.00
R3828:Rsg1 UTSW 4 141218589 missense probably damaging 1.00
R3829:Rsg1 UTSW 4 141218589 missense probably damaging 1.00
R3830:Rsg1 UTSW 4 141218589 missense probably damaging 1.00
R5076:Rsg1 UTSW 4 141217385 missense probably benign 0.00
R5242:Rsg1 UTSW 4 141219847 missense probably damaging 1.00
R5527:Rsg1 UTSW 4 141219992 missense probably damaging 1.00
R5610:Rsg1 UTSW 4 141219866 missense probably benign 0.00
R5677:Rsg1 UTSW 4 141219866 missense probably benign 0.00
R6049:Rsg1 UTSW 4 141218162 missense probably benign 0.18
R6543:Rsg1 UTSW 4 141217288 missense probably benign
R7078:Rsg1 UTSW 4 141219848 missense probably benign 0.01
R7483:Rsg1 UTSW 4 141219842 missense probably damaging 1.00
R8046:Rsg1 UTSW 4 141220037 missense probably damaging 1.00
R8169:Rsg1 UTSW 4 141218219 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGGAGCCTGACTTGAACATTAG -3'
(R):5'- TAGGGGCCACTCAAAGGATACTTGG -3'

Sequencing Primer
(F):5'- ACTGGGTCTTGCATTCCagc -3'
(R):5'- TGGACCCGATAACTATCTTGACG -3'
Posted On2014-02-11