Incidental Mutation 'R1340:Olfr364-ps1'
ID156982
Institutional Source Beutler Lab
Gene Symbol Olfr364-ps1
Ensembl Gene ENSMUSG00000078198
Gene Nameolfactory receptor 364, pseudogene 1
SynonymsGA_x6K02T2NLDC-33831282-33832243, MOR138-4P, MOR138-7
MMRRC Submission 039405-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R1340 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location37139322-37148585 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 37146757 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Valine at position 182 (L182V)
Ref Sequence ENSEMBL: ENSMUSP00000151166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000104995] [ENSMUST00000214905] [ENSMUST00000217298]
Predicted Effect probably benign
Transcript: ENSMUST00000104995
AA Change: L182V

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000100611
Gene: ENSMUSG00000078198
AA Change: L182V

DomainStartEndE-ValueType
Pfam:7tm_4 28 303 4.8e-58 PFAM
Pfam:7tm_1 38 287 5e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214905
AA Change: L182V

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000217298
AA Change: L182V

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
Meta Mutation Damage Score 0.1404 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 89.9%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A T 6: 142,682,855 probably benign Het
Acat3 C T 17: 12,929,677 probably benign Het
Actn1 T C 12: 80,173,144 probably null Het
Adam8 G A 7: 139,991,377 S38F probably damaging Het
Aldh9a1 T G 1: 167,357,344 I275S probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Alms1 G A 6: 85,667,957 probably null Het
Cacna1d A G 14: 30,072,067 V1539A probably damaging Het
Cacna1e A G 1: 154,472,657 L724P probably damaging Het
Ccdc110 A G 8: 45,942,181 T370A probably benign Het
Ccdc9 G A 7: 16,275,390 probably benign Het
Cep120 A T 18: 53,724,391 V334E probably damaging Het
Ces3a C T 8: 105,057,913 P462L probably damaging Het
Cgref1 A G 5: 30,945,346 probably benign Het
Cndp1 G A 18: 84,634,652 probably benign Het
Csrnp3 T A 2: 66,002,396 F81Y probably damaging Het
Ddr2 T C 1: 169,998,084 T316A probably benign Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Epb41l5 A T 1: 119,549,131 *740R probably null Het
Gfpt2 A G 11: 49,832,861 K559E probably damaging Het
Gm2381 A G 7: 42,820,404 Y99H possibly damaging Het
Gsdma2 T C 11: 98,657,649 V242A probably damaging Het
Lrp1b T C 2: 40,702,794 N3771S probably benign Het
Lrriq4 A C 3: 30,650,323 T167P possibly damaging Het
Marc2 T C 1: 184,822,547 T254A probably benign Het
Naip2 G A 13: 100,189,122 L93F possibly damaging Het
Nefh G GNNNNNNNNNNNNNNNNNN 11: 4,941,002 probably benign Het
Nrp1 T C 8: 128,434,355 S321P probably damaging Het
Nt5c1b T C 12: 10,377,276 V342A probably damaging Het
Nt5c3 A G 6: 56,883,033 M273T probably benign Het
Olfr449 G A 6: 42,838,009 V43M probably benign Het
Olfr527 A G 7: 140,336,125 T88A probably benign Het
Polr3f A G 2: 144,538,628 H297R probably benign Het
Ptgs2 T G 1: 150,105,477 F504V probably damaging Het
Ptpro C T 6: 137,441,081 P142L possibly damaging Het
Rps17 A G 7: 81,343,733 probably null Het
Ryr1 A G 7: 29,116,012 S132P probably damaging Het
Sacs T C 14: 61,204,509 S1335P probably damaging Het
Senp6 T C 9: 80,122,023 V383A possibly damaging Het
Skint7 T C 4: 111,980,219 F65L probably damaging Het
Slc35f1 T C 10: 53,089,454 Y322H probably damaging Het
Slc38a4 C A 15: 97,010,272 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Sox15 T A 11: 69,655,547 S59T probably damaging Het
Srcap T A 7: 127,560,738 probably benign Het
Txlnb A T 10: 17,842,740 I440F probably damaging Het
Uhrf1bp1 A G 17: 27,894,721 N1289S probably benign Het
Vmn1r178 A G 7: 23,893,856 S37G probably benign Het
Vmn2r75 T C 7: 86,148,590 T672A probably damaging Het
Wscd1 T C 11: 71,768,760 V222A probably benign Het
Other mutations in Olfr364-ps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Olfr364-ps1 APN 2 37147067 missense probably damaging 1.00
IGL01550:Olfr364-ps1 APN 2 37146974 missense probably damaging 1.00
IGL01791:Olfr364-ps1 APN 2 37146536 missense probably damaging 1.00
IGL01886:Olfr364-ps1 APN 2 37146509 missense probably damaging 1.00
IGL02680:Olfr364-ps1 APN 2 37146415 missense probably damaging 1.00
IGL03003:Olfr364-ps1 APN 2 37146452 missense probably benign 0.00
IGL03289:Olfr364-ps1 APN 2 37146578 missense probably damaging 1.00
R0627:Olfr364-ps1 UTSW 2 37146330 missense probably damaging 0.96
R1163:Olfr364-ps1 UTSW 2 37147027 missense probably damaging 1.00
R1253:Olfr364-ps1 UTSW 2 37146872 missense possibly damaging 0.89
R1542:Olfr364-ps1 UTSW 2 37146966 missense probably damaging 1.00
R1633:Olfr364-ps1 UTSW 2 37146971 missense probably damaging 0.99
R2935:Olfr364-ps1 UTSW 2 37147111 missense possibly damaging 0.75
R2982:Olfr364-ps1 UTSW 2 37146381 missense probably damaging 0.99
R3855:Olfr364-ps1 UTSW 2 37146823 missense possibly damaging 0.95
R4849:Olfr364-ps1 UTSW 2 37146254 missense probably damaging 0.97
R4903:Olfr364-ps1 UTSW 2 37146371 missense probably benign 0.35
R5160:Olfr364-ps1 UTSW 2 37146803 missense probably benign 0.03
R7092:Olfr364-ps1 UTSW 2 37146611 missense probably damaging 1.00
R7108:Olfr364-ps1 UTSW 2 37146260 missense probably benign 0.00
R7143:Olfr364-ps1 UTSW 2 37146874 missense probably benign 0.00
R7278:Olfr364-ps1 UTSW 2 37147009 missense probably benign 0.29
Z1088:Olfr364-ps1 UTSW 2 37146385 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TGATGTGGTGATGAGGTCACAACG -3'
(R):5'- GAGTGAAGCCTGTCCCTTAACTTCC -3'

Sequencing Primer
(F):5'- ATGAGGTCACAACGCTGCC -3'
(R):5'- TACATAACAGTGGCTATCCGGTC -3'
Posted On2014-02-11