Incidental Mutation 'R1340:Olfr449'
ID156989
Institutional Source Beutler Lab
Gene Symbol Olfr449
Ensembl Gene ENSMUSG00000049168
Gene Nameolfactory receptor 449
SynonymsGA_x6K02T2P3E9-4722003-4721068, MOR103-1
MMRRC Submission 039405-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R1340 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location42834384-42839516 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 42838009 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 43 (V43M)
Ref Sequence ENSEMBL: ENSMUSP00000145055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050729] [ENSMUST00000204072] [ENSMUST00000204229] [ENSMUST00000214687]
Predicted Effect probably benign
Transcript: ENSMUST00000050729
AA Change: V43M

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000059233
Gene: ENSMUSG00000049168
AA Change: V43M

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 2.7e-52 PFAM
Pfam:7tm_1 41 288 2e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203135
AA Change: V43M
SMART Domains Protein: ENSMUSP00000144965
Gene: ENSMUSG00000049168
AA Change: V43M

DomainStartEndE-ValueType
Pfam:7tm_4 31 193 2.1e-32 PFAM
Pfam:7tm_1 41 193 7.7e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204072
AA Change: V43M

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000204229
AA Change: V43M

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000145055
Gene: ENSMUSG00000049168
AA Change: V43M

DomainStartEndE-ValueType
Pfam:7tm_4 31 130 1.7e-20 PFAM
Pfam:7tm_1 41 130 2.6e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214687
AA Change: V43M

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0762 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 89.9%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A T 6: 142,682,855 probably benign Het
Acat3 C T 17: 12,929,677 probably benign Het
Actn1 T C 12: 80,173,144 probably null Het
Adam8 G A 7: 139,991,377 S38F probably damaging Het
Aldh9a1 T G 1: 167,357,344 I275S probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Alms1 G A 6: 85,667,957 probably null Het
Cacna1d A G 14: 30,072,067 V1539A probably damaging Het
Cacna1e A G 1: 154,472,657 L724P probably damaging Het
Ccdc110 A G 8: 45,942,181 T370A probably benign Het
Ccdc9 G A 7: 16,275,390 probably benign Het
Cep120 A T 18: 53,724,391 V334E probably damaging Het
Ces3a C T 8: 105,057,913 P462L probably damaging Het
Cgref1 A G 5: 30,945,346 probably benign Het
Cndp1 G A 18: 84,634,652 probably benign Het
Csrnp3 T A 2: 66,002,396 F81Y probably damaging Het
Ddr2 T C 1: 169,998,084 T316A probably benign Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Epb41l5 A T 1: 119,549,131 *740R probably null Het
Gfpt2 A G 11: 49,832,861 K559E probably damaging Het
Gm2381 A G 7: 42,820,404 Y99H possibly damaging Het
Gsdma2 T C 11: 98,657,649 V242A probably damaging Het
Lrp1b T C 2: 40,702,794 N3771S probably benign Het
Lrriq4 A C 3: 30,650,323 T167P possibly damaging Het
Marc2 T C 1: 184,822,547 T254A probably benign Het
Naip2 G A 13: 100,189,122 L93F possibly damaging Het
Nefh G GNNNNNNNNNNNNNNNNNN 11: 4,941,002 probably benign Het
Nrp1 T C 8: 128,434,355 S321P probably damaging Het
Nt5c1b T C 12: 10,377,276 V342A probably damaging Het
Nt5c3 A G 6: 56,883,033 M273T probably benign Het
Olfr364-ps1 T G 2: 37,146,757 L182V probably benign Het
Olfr527 A G 7: 140,336,125 T88A probably benign Het
Polr3f A G 2: 144,538,628 H297R probably benign Het
Ptgs2 T G 1: 150,105,477 F504V probably damaging Het
Ptpro C T 6: 137,441,081 P142L possibly damaging Het
Rps17 A G 7: 81,343,733 probably null Het
Ryr1 A G 7: 29,116,012 S132P probably damaging Het
Sacs T C 14: 61,204,509 S1335P probably damaging Het
Senp6 T C 9: 80,122,023 V383A possibly damaging Het
Skint7 T C 4: 111,980,219 F65L probably damaging Het
Slc35f1 T C 10: 53,089,454 Y322H probably damaging Het
Slc38a4 C A 15: 97,010,272 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Sox15 T A 11: 69,655,547 S59T probably damaging Het
Srcap T A 7: 127,560,738 probably benign Het
Txlnb A T 10: 17,842,740 I440F probably damaging Het
Uhrf1bp1 A G 17: 27,894,721 N1289S probably benign Het
Vmn1r178 A G 7: 23,893,856 S37G probably benign Het
Vmn2r75 T C 7: 86,148,590 T672A probably damaging Het
Wscd1 T C 11: 71,768,760 V222A probably benign Het
Other mutations in Olfr449
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01904:Olfr449 APN 6 42838289 missense possibly damaging 0.76
IGL02193:Olfr449 APN 6 42838819 utr 3 prime probably benign
IGL02496:Olfr449 APN 6 42838804 missense probably benign 0.00
IGL03302:Olfr449 APN 6 42838003 nonsense probably null
IGL03333:Olfr449 APN 6 42838703 missense possibly damaging 0.95
R1926:Olfr449 UTSW 6 42838313 missense probably damaging 1.00
R2418:Olfr449 UTSW 6 42838049 missense probably benign 0.03
R4837:Olfr449 UTSW 6 42837849 splice site probably null
R5466:Olfr449 UTSW 6 42838093 missense probably benign 0.08
R5733:Olfr449 UTSW 6 42838246 missense probably damaging 0.97
R6411:Olfr449 UTSW 6 42838720 missense possibly damaging 0.57
R6626:Olfr449 UTSW 6 42838648 missense probably benign 0.14
R6912:Olfr449 UTSW 6 42838802 missense probably benign
R7278:Olfr449 UTSW 6 42834396 splice site probably null
R7399:Olfr449 UTSW 6 42838746 nonsense probably null
R7703:Olfr449 UTSW 6 42838004 missense probably damaging 1.00
R8325:Olfr449 UTSW 6 42838190 missense probably damaging 1.00
Z1176:Olfr449 UTSW 6 42837977 missense probably damaging 1.00
Z1177:Olfr449 UTSW 6 42838376 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTCTCAGAAAGGCTAGGTCCTGTG -3'
(R):5'- AAGTCCACCAGCTCTGCAATGG -3'

Sequencing Primer
(F):5'- GTACTTGATATGGATGTGGACAACC -3'
(R):5'- GATCTTTGCCAAAGAGATGCC -3'
Posted On2014-02-11