Incidental Mutation 'R1340:Ccdc9'
ID156994
Institutional Source Beutler Lab
Gene Symbol Ccdc9
Ensembl Gene ENSMUSG00000041375
Gene Namecoiled-coil domain containing 9
Synonyms
MMRRC Submission 039405-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R1340 (G1)
Quality Score162
Status Validated
Chromosome7
Chromosomal Location16274042-16286795 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 16275390 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041010] [ENSMUST00000118976] [ENSMUST00000169612]
Predicted Effect probably benign
Transcript: ENSMUST00000041010
SMART Domains Protein: ENSMUSP00000035597
Gene: ENSMUSG00000041375

DomainStartEndE-ValueType
coiled coil region 5 52 N/A INTRINSIC
low complexity region 75 95 N/A INTRINSIC
low complexity region 121 135 N/A INTRINSIC
coiled coil region 150 184 N/A INTRINSIC
Pfam:DUF4594 203 378 1.1e-63 PFAM
coiled coil region 425 453 N/A INTRINSIC
low complexity region 490 507 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118976
SMART Domains Protein: ENSMUSP00000114088
Gene: ENSMUSG00000041375

DomainStartEndE-ValueType
coiled coil region 5 52 N/A INTRINSIC
low complexity region 75 95 N/A INTRINSIC
low complexity region 121 135 N/A INTRINSIC
coiled coil region 150 184 N/A INTRINSIC
Pfam:DUF4594 204 375 6.3e-57 PFAM
coiled coil region 425 453 N/A INTRINSIC
low complexity region 490 507 N/A INTRINSIC
low complexity region 535 549 N/A INTRINSIC
low complexity region 580 588 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124084
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129447
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131963
Predicted Effect probably benign
Transcript: ENSMUST00000146085
SMART Domains Protein: ENSMUSP00000134049
Gene: ENSMUSG00000041375

DomainStartEndE-ValueType
Pfam:DUF4594 1 85 5.2e-16 PFAM
coiled coil region 135 163 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169612
SMART Domains Protein: ENSMUSP00000127027
Gene: ENSMUSG00000091811

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
Pfam:InaF-motif 24 61 2.6e-20 PFAM
low complexity region 104 120 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172670
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 89.9%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A T 6: 142,682,855 probably benign Het
Acat3 C T 17: 12,929,677 probably benign Het
Actn1 T C 12: 80,173,144 probably null Het
Adam8 G A 7: 139,991,377 S38F probably damaging Het
Aldh9a1 T G 1: 167,357,344 I275S probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Alms1 G A 6: 85,667,957 probably null Het
Cacna1d A G 14: 30,072,067 V1539A probably damaging Het
Cacna1e A G 1: 154,472,657 L724P probably damaging Het
Ccdc110 A G 8: 45,942,181 T370A probably benign Het
Cep120 A T 18: 53,724,391 V334E probably damaging Het
Ces3a C T 8: 105,057,913 P462L probably damaging Het
Cgref1 A G 5: 30,945,346 probably benign Het
Cndp1 G A 18: 84,634,652 probably benign Het
Csrnp3 T A 2: 66,002,396 F81Y probably damaging Het
Ddr2 T C 1: 169,998,084 T316A probably benign Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Epb41l5 A T 1: 119,549,131 *740R probably null Het
Gfpt2 A G 11: 49,832,861 K559E probably damaging Het
Gm2381 A G 7: 42,820,404 Y99H possibly damaging Het
Gsdma2 T C 11: 98,657,649 V242A probably damaging Het
Lrp1b T C 2: 40,702,794 N3771S probably benign Het
Lrriq4 A C 3: 30,650,323 T167P possibly damaging Het
Marc2 T C 1: 184,822,547 T254A probably benign Het
Naip2 G A 13: 100,189,122 L93F possibly damaging Het
Nefh G GNNNNNNNNNNNNNNNNNN 11: 4,941,002 probably benign Het
Nrp1 T C 8: 128,434,355 S321P probably damaging Het
Nt5c1b T C 12: 10,377,276 V342A probably damaging Het
Nt5c3 A G 6: 56,883,033 M273T probably benign Het
Olfr364-ps1 T G 2: 37,146,757 L182V probably benign Het
Olfr449 G A 6: 42,838,009 V43M probably benign Het
Olfr527 A G 7: 140,336,125 T88A probably benign Het
Polr3f A G 2: 144,538,628 H297R probably benign Het
Ptgs2 T G 1: 150,105,477 F504V probably damaging Het
Ptpro C T 6: 137,441,081 P142L possibly damaging Het
Rps17 A G 7: 81,343,733 probably null Het
Ryr1 A G 7: 29,116,012 S132P probably damaging Het
Sacs T C 14: 61,204,509 S1335P probably damaging Het
Senp6 T C 9: 80,122,023 V383A possibly damaging Het
Skint7 T C 4: 111,980,219 F65L probably damaging Het
Slc35f1 T C 10: 53,089,454 Y322H probably damaging Het
Slc38a4 C A 15: 97,010,272 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Sox15 T A 11: 69,655,547 S59T probably damaging Het
Srcap T A 7: 127,560,738 probably benign Het
Txlnb A T 10: 17,842,740 I440F probably damaging Het
Uhrf1bp1 A G 17: 27,894,721 N1289S probably benign Het
Vmn1r178 A G 7: 23,893,856 S37G probably benign Het
Vmn2r75 T C 7: 86,148,590 T672A probably damaging Het
Wscd1 T C 11: 71,768,760 V222A probably benign Het
Other mutations in Ccdc9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01387:Ccdc9 APN 7 16284499 start codon destroyed probably null 0.01
IGL02167:Ccdc9 APN 7 16284359 nonsense probably null
IGL02513:Ccdc9 APN 7 16284509 utr 5 prime probably benign
IGL02805:Ccdc9 APN 7 16275274 missense probably benign 0.01
R0537:Ccdc9 UTSW 7 16280776 unclassified probably benign
R0631:Ccdc9 UTSW 7 16278459 missense probably damaging 1.00
R1758:Ccdc9 UTSW 7 16276236 missense probably damaging 0.99
R2067:Ccdc9 UTSW 7 16278550 splice site probably null
R2207:Ccdc9 UTSW 7 16284269 critical splice donor site probably benign
R5278:Ccdc9 UTSW 7 16278381 nonsense probably null
R5371:Ccdc9 UTSW 7 16280730 missense probably damaging 1.00
R7341:Ccdc9 UTSW 7 16280627 missense probably damaging 1.00
R7526:Ccdc9 UTSW 7 16282400 missense probably damaging 0.98
R7556:Ccdc9 UTSW 7 16284566 intron probably benign
R7683:Ccdc9 UTSW 7 16284362 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTGCCCAGCGTTCAAAGTTATTC -3'
(R):5'- AGTTCCCAAAGCCTGCTCTTGC -3'

Sequencing Primer
(F):5'- TTGCACCCCAAAGGCTTG -3'
(R):5'- TTGCTGGTTCAGAGCCTC -3'
Posted On2014-02-11