Incidental Mutation 'R1340:Vmn1r178'
ID156995
Institutional Source Beutler Lab
Gene Symbol Vmn1r178
Ensembl Gene ENSMUSG00000062598
Gene Namevomeronasal 1 receptor 178
SynonymsV1rd13, LOC232959
MMRRC Submission 039405-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R1340 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location23892009-23895622 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23893856 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 37 (S37G)
Ref Sequence ENSEMBL: ENSMUSP00000154374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078593] [ENSMUST00000226450] [ENSMUST00000226489] [ENSMUST00000226640] [ENSMUST00000227993]
Predicted Effect probably benign
Transcript: ENSMUST00000078593
AA Change: S110G

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000077666
Gene: ENSMUSG00000062598
AA Change: S110G

DomainStartEndE-ValueType
Pfam:TAS2R 8 297 7.9e-11 PFAM
Pfam:7tm_1 15 283 2.5e-7 PFAM
Pfam:V1R 41 296 7.8e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226450
AA Change: S110G

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000226489
AA Change: S37G

PolyPhen 2 Score 0.342 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000226640
AA Change: S37G

PolyPhen 2 Score 0.342 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000227993
AA Change: S110G

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 89.9%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A T 6: 142,682,855 probably benign Het
Acat3 C T 17: 12,929,677 probably benign Het
Actn1 T C 12: 80,173,144 probably null Het
Adam8 G A 7: 139,991,377 S38F probably damaging Het
Aldh9a1 T G 1: 167,357,344 I275S probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Alms1 G A 6: 85,667,957 probably null Het
Cacna1d A G 14: 30,072,067 V1539A probably damaging Het
Cacna1e A G 1: 154,472,657 L724P probably damaging Het
Ccdc110 A G 8: 45,942,181 T370A probably benign Het
Ccdc9 G A 7: 16,275,390 probably benign Het
Cep120 A T 18: 53,724,391 V334E probably damaging Het
Ces3a C T 8: 105,057,913 P462L probably damaging Het
Cgref1 A G 5: 30,945,346 probably benign Het
Cndp1 G A 18: 84,634,652 probably benign Het
Csrnp3 T A 2: 66,002,396 F81Y probably damaging Het
Ddr2 T C 1: 169,998,084 T316A probably benign Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Epb41l5 A T 1: 119,549,131 *740R probably null Het
Gfpt2 A G 11: 49,832,861 K559E probably damaging Het
Gm2381 A G 7: 42,820,404 Y99H possibly damaging Het
Gsdma2 T C 11: 98,657,649 V242A probably damaging Het
Lrp1b T C 2: 40,702,794 N3771S probably benign Het
Lrriq4 A C 3: 30,650,323 T167P possibly damaging Het
Marc2 T C 1: 184,822,547 T254A probably benign Het
Naip2 G A 13: 100,189,122 L93F possibly damaging Het
Nefh G GNNNNNNNNNNNNNNNNNN 11: 4,941,002 probably benign Het
Nrp1 T C 8: 128,434,355 S321P probably damaging Het
Nt5c1b T C 12: 10,377,276 V342A probably damaging Het
Nt5c3 A G 6: 56,883,033 M273T probably benign Het
Olfr364-ps1 T G 2: 37,146,757 L182V probably benign Het
Olfr449 G A 6: 42,838,009 V43M probably benign Het
Olfr527 A G 7: 140,336,125 T88A probably benign Het
Polr3f A G 2: 144,538,628 H297R probably benign Het
Ptgs2 T G 1: 150,105,477 F504V probably damaging Het
Ptpro C T 6: 137,441,081 P142L possibly damaging Het
Rps17 A G 7: 81,343,733 probably null Het
Ryr1 A G 7: 29,116,012 S132P probably damaging Het
Sacs T C 14: 61,204,509 S1335P probably damaging Het
Senp6 T C 9: 80,122,023 V383A possibly damaging Het
Skint7 T C 4: 111,980,219 F65L probably damaging Het
Slc35f1 T C 10: 53,089,454 Y322H probably damaging Het
Slc38a4 C A 15: 97,010,272 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Sox15 T A 11: 69,655,547 S59T probably damaging Het
Srcap T A 7: 127,560,738 probably benign Het
Txlnb A T 10: 17,842,740 I440F probably damaging Het
Uhrf1bp1 A G 17: 27,894,721 N1289S probably benign Het
Vmn2r75 T C 7: 86,148,590 T672A probably damaging Het
Wscd1 T C 11: 71,768,760 V222A probably benign Het
Other mutations in Vmn1r178
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01697:Vmn1r178 APN 7 23893689 missense probably damaging 0.99
IGL01781:Vmn1r178 APN 7 23894009 missense probably damaging 1.00
IGL01934:Vmn1r178 APN 7 23893937 missense probably damaging 1.00
IGL02571:Vmn1r178 APN 7 23894235 missense probably damaging 0.99
IGL02727:Vmn1r178 APN 7 23894446 unclassified probably null
IGL03112:Vmn1r178 APN 7 23893661 missense probably damaging 1.00
R0112:Vmn1r178 UTSW 7 23894184 missense possibly damaging 0.93
R0830:Vmn1r178 UTSW 7 23894027 missense possibly damaging 0.91
R1186:Vmn1r178 UTSW 7 23893892 nonsense probably null
R1640:Vmn1r178 UTSW 7 23894123 missense possibly damaging 0.70
R1696:Vmn1r178 UTSW 7 23894200 missense probably damaging 0.99
R1746:Vmn1r178 UTSW 7 23893904 missense probably benign 0.00
R3084:Vmn1r178 UTSW 7 23893906 missense possibly damaging 0.94
R4368:Vmn1r178 UTSW 7 23894022 missense probably damaging 1.00
R5199:Vmn1r178 UTSW 7 23894389 missense probably benign 0.11
R6380:Vmn1r178 UTSW 7 23893559 missense possibly damaging 0.62
R7000:Vmn1r178 UTSW 7 23894337 missense probably benign 0.21
R7142:Vmn1r178 UTSW 7 23893610 missense probably damaging 1.00
R7268:Vmn1r178 UTSW 7 23893953 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGGTTCTAAACAGAGGCCCAGACAG -3'
(R):5'- GCCATCATGGAAAATCCGCAAGAAG -3'

Sequencing Primer
(F):5'- GCCCAGACAGTTGATTTTAAGCC -3'
(R):5'- CAGAACAACTTGCTTTTAGAGTCAG -3'
Posted On2014-02-11