Incidental Mutation 'R1340:Ces3a'
ID157004
Institutional Source Beutler Lab
Gene Symbol Ces3a
Ensembl Gene ENSMUSG00000069922
Gene Namecarboxylesterase 3A
SynonymsEs31, Es-male carboxylesterase
MMRRC Submission 039405-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R1340 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location105048601-105058413 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 105057913 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 462 (P462L)
Ref Sequence ENSEMBL: ENSMUSP00000090911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093222] [ENSMUST00000093223]
Predicted Effect probably damaging
Transcript: ENSMUST00000093222
AA Change: P509L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000090910
Gene: ENSMUSG00000069922
AA Change: P509L

DomainStartEndE-ValueType
Pfam:COesterase 16 547 1.1e-163 PFAM
Pfam:Abhydrolase_3 147 305 5.2e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000093223
AA Change: P462L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090911
Gene: ENSMUSG00000069922
AA Change: P462L

DomainStartEndE-ValueType
Pfam:COesterase 16 320 1.4e-111 PFAM
Pfam:Abhydrolase_3 147 319 4.8e-14 PFAM
Pfam:COesterase 312 500 1.2e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212481
Meta Mutation Damage Score 0.8540 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 89.9%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A T 6: 142,682,855 probably benign Het
Acat3 C T 17: 12,929,677 probably benign Het
Actn1 T C 12: 80,173,144 probably null Het
Adam8 G A 7: 139,991,377 S38F probably damaging Het
Aldh9a1 T G 1: 167,357,344 I275S probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Alms1 G A 6: 85,667,957 probably null Het
Cacna1d A G 14: 30,072,067 V1539A probably damaging Het
Cacna1e A G 1: 154,472,657 L724P probably damaging Het
Ccdc110 A G 8: 45,942,181 T370A probably benign Het
Ccdc9 G A 7: 16,275,390 probably benign Het
Cep120 A T 18: 53,724,391 V334E probably damaging Het
Cgref1 A G 5: 30,945,346 probably benign Het
Cndp1 G A 18: 84,634,652 probably benign Het
Csrnp3 T A 2: 66,002,396 F81Y probably damaging Het
Ddr2 T C 1: 169,998,084 T316A probably benign Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Epb41l5 A T 1: 119,549,131 *740R probably null Het
Gfpt2 A G 11: 49,832,861 K559E probably damaging Het
Gm2381 A G 7: 42,820,404 Y99H possibly damaging Het
Gsdma2 T C 11: 98,657,649 V242A probably damaging Het
Lrp1b T C 2: 40,702,794 N3771S probably benign Het
Lrriq4 A C 3: 30,650,323 T167P possibly damaging Het
Marc2 T C 1: 184,822,547 T254A probably benign Het
Naip2 G A 13: 100,189,122 L93F possibly damaging Het
Nefh G GNNNNNNNNNNNNNNNNNN 11: 4,941,002 probably benign Het
Nrp1 T C 8: 128,434,355 S321P probably damaging Het
Nt5c1b T C 12: 10,377,276 V342A probably damaging Het
Nt5c3 A G 6: 56,883,033 M273T probably benign Het
Olfr364-ps1 T G 2: 37,146,757 L182V probably benign Het
Olfr449 G A 6: 42,838,009 V43M probably benign Het
Olfr527 A G 7: 140,336,125 T88A probably benign Het
Polr3f A G 2: 144,538,628 H297R probably benign Het
Ptgs2 T G 1: 150,105,477 F504V probably damaging Het
Ptpro C T 6: 137,441,081 P142L possibly damaging Het
Rps17 A G 7: 81,343,733 probably null Het
Ryr1 A G 7: 29,116,012 S132P probably damaging Het
Sacs T C 14: 61,204,509 S1335P probably damaging Het
Senp6 T C 9: 80,122,023 V383A possibly damaging Het
Skint7 T C 4: 111,980,219 F65L probably damaging Het
Slc35f1 T C 10: 53,089,454 Y322H probably damaging Het
Slc38a4 C A 15: 97,010,272 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Sox15 T A 11: 69,655,547 S59T probably damaging Het
Srcap T A 7: 127,560,738 probably benign Het
Txlnb A T 10: 17,842,740 I440F probably damaging Het
Uhrf1bp1 A G 17: 27,894,721 N1289S probably benign Het
Vmn1r178 A G 7: 23,893,856 S37G probably benign Het
Vmn2r75 T C 7: 86,148,590 T672A probably damaging Het
Wscd1 T C 11: 71,768,760 V222A probably benign Het
Other mutations in Ces3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Ces3a APN 8 105050570 missense probably damaging 1.00
IGL01557:Ces3a APN 8 105057751 missense probably damaging 1.00
IGL02092:Ces3a APN 8 105050330 splice site probably benign
IGL02140:Ces3a APN 8 105055631 missense probably benign 0.07
K3955:Ces3a UTSW 8 105050627 splice site probably benign
R0724:Ces3a UTSW 8 105050195 missense possibly damaging 0.73
R1066:Ces3a UTSW 8 105055656 missense probably benign 0.01
R1223:Ces3a UTSW 8 105058029 missense probably benign 0.00
R1224:Ces3a UTSW 8 105051509 missense probably damaging 1.00
R1513:Ces3a UTSW 8 105050277 missense probably damaging 1.00
R1740:Ces3a UTSW 8 105048685 missense probably damaging 1.00
R2192:Ces3a UTSW 8 105055580 missense probably benign
R3407:Ces3a UTSW 8 105050567 missense probably damaging 1.00
R4002:Ces3a UTSW 8 105057461 missense probably damaging 1.00
R4668:Ces3a UTSW 8 105053423 missense probably damaging 1.00
R5045:Ces3a UTSW 8 105050616 critical splice donor site probably null
R5331:Ces3a UTSW 8 105057556 missense probably damaging 1.00
R5450:Ces3a UTSW 8 105057918 missense possibly damaging 0.83
R5535:Ces3a UTSW 8 105051564 missense probably benign 0.34
R5640:Ces3a UTSW 8 105051745 missense probably benign 0.42
R5881:Ces3a UTSW 8 105050566 missense probably damaging 1.00
R6795:Ces3a UTSW 8 105050596 missense possibly damaging 0.94
R7112:Ces3a UTSW 8 105057962 missense probably damaging 1.00
R7323:Ces3a UTSW 8 105055607 missense possibly damaging 0.54
R7419:Ces3a UTSW 8 105056424 missense probably damaging 1.00
R7793:Ces3a UTSW 8 105055661 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCTGACCATTCCTCTGAGAATGCC -3'
(R):5'- AGTTGCCCTGCTTGGATGCTAC -3'

Sequencing Primer
(F):5'- TATCTCCAGTCAGTGTCAGGGAC -3'
(R):5'- AAGGTCCAGGTAGGTCTGGC -3'
Posted On2014-02-11