Incidental Mutation 'R1340:Slc35f1'
ID157008
Institutional Source Beutler Lab
Gene Symbol Slc35f1
Ensembl Gene ENSMUSG00000038602
Gene Namesolute carrier family 35, member F1
Synonyms
MMRRC Submission 039405-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1340 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location52690533-53111622 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53089454 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 322 (Y322H)
Ref Sequence ENSEMBL: ENSMUSP00000101113 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105473]
Predicted Effect probably damaging
Transcript: ENSMUST00000105473
AA Change: Y322H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101113
Gene: ENSMUSG00000038602
AA Change: Y322H

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
Pfam:SLC35F 56 355 1.4e-151 PFAM
Pfam:CRT-like 66 315 2.3e-13 PFAM
Pfam:EamA 217 355 1.7e-9 PFAM
Meta Mutation Damage Score 0.3736 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 89.9%
Validation Efficiency 100% (52/52)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit no detectable phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A T 6: 142,682,855 probably benign Het
Acat3 C T 17: 12,929,677 probably benign Het
Actn1 T C 12: 80,173,144 probably null Het
Adam8 G A 7: 139,991,377 S38F probably damaging Het
Aldh9a1 T G 1: 167,357,344 I275S probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Alms1 G A 6: 85,667,957 probably null Het
Cacna1d A G 14: 30,072,067 V1539A probably damaging Het
Cacna1e A G 1: 154,472,657 L724P probably damaging Het
Ccdc110 A G 8: 45,942,181 T370A probably benign Het
Ccdc9 G A 7: 16,275,390 probably benign Het
Cep120 A T 18: 53,724,391 V334E probably damaging Het
Ces3a C T 8: 105,057,913 P462L probably damaging Het
Cgref1 A G 5: 30,945,346 probably benign Het
Cndp1 G A 18: 84,634,652 probably benign Het
Csrnp3 T A 2: 66,002,396 F81Y probably damaging Het
Ddr2 T C 1: 169,998,084 T316A probably benign Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Epb41l5 A T 1: 119,549,131 *740R probably null Het
Gfpt2 A G 11: 49,832,861 K559E probably damaging Het
Gm2381 A G 7: 42,820,404 Y99H possibly damaging Het
Gsdma2 T C 11: 98,657,649 V242A probably damaging Het
Lrp1b T C 2: 40,702,794 N3771S probably benign Het
Lrriq4 A C 3: 30,650,323 T167P possibly damaging Het
Marc2 T C 1: 184,822,547 T254A probably benign Het
Naip2 G A 13: 100,189,122 L93F possibly damaging Het
Nefh G GNNNNNNNNNNNNNNNNNN 11: 4,941,002 probably benign Het
Nrp1 T C 8: 128,434,355 S321P probably damaging Het
Nt5c1b T C 12: 10,377,276 V342A probably damaging Het
Nt5c3 A G 6: 56,883,033 M273T probably benign Het
Olfr364-ps1 T G 2: 37,146,757 L182V probably benign Het
Olfr449 G A 6: 42,838,009 V43M probably benign Het
Olfr527 A G 7: 140,336,125 T88A probably benign Het
Polr3f A G 2: 144,538,628 H297R probably benign Het
Ptgs2 T G 1: 150,105,477 F504V probably damaging Het
Ptpro C T 6: 137,441,081 P142L possibly damaging Het
Rps17 A G 7: 81,343,733 probably null Het
Ryr1 A G 7: 29,116,012 S132P probably damaging Het
Sacs T C 14: 61,204,509 S1335P probably damaging Het
Senp6 T C 9: 80,122,023 V383A possibly damaging Het
Skint7 T C 4: 111,980,219 F65L probably damaging Het
Slc38a4 C A 15: 97,010,272 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Sox15 T A 11: 69,655,547 S59T probably damaging Het
Srcap T A 7: 127,560,738 probably benign Het
Txlnb A T 10: 17,842,740 I440F probably damaging Het
Uhrf1bp1 A G 17: 27,894,721 N1289S probably benign Het
Vmn1r178 A G 7: 23,893,856 S37G probably benign Het
Vmn2r75 T C 7: 86,148,590 T672A probably damaging Het
Wscd1 T C 11: 71,768,760 V222A probably benign Het
Other mutations in Slc35f1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Slc35f1 APN 10 53062452 missense probably damaging 1.00
IGL01073:Slc35f1 APN 10 53021960 missense probably benign 0.16
IGL01433:Slc35f1 APN 10 53073446 splice site probably benign
IGL01566:Slc35f1 APN 10 53089455 missense probably damaging 1.00
IGL02693:Slc35f1 APN 10 52933128 missense probably damaging 1.00
IGL02870:Slc35f1 APN 10 52933207 missense possibly damaging 0.82
IGL03082:Slc35f1 APN 10 52933138 missense probably benign
R0884:Slc35f1 UTSW 10 53089347 missense probably damaging 1.00
R1781:Slc35f1 UTSW 10 53062436 splice site probably null
R1813:Slc35f1 UTSW 10 52933195 missense probably damaging 1.00
R1908:Slc35f1 UTSW 10 53021904 missense possibly damaging 0.84
R2044:Slc35f1 UTSW 10 53089347 missense probably damaging 1.00
R2518:Slc35f1 UTSW 10 53073534 missense probably benign 0.07
R3872:Slc35f1 UTSW 10 53021910 missense possibly damaging 0.87
R3934:Slc35f1 UTSW 10 53108218 missense probably damaging 1.00
R3935:Slc35f1 UTSW 10 53108218 missense probably damaging 1.00
R3936:Slc35f1 UTSW 10 53108218 missense probably damaging 1.00
R4118:Slc35f1 UTSW 10 53089368 missense probably damaging 0.98
R4921:Slc35f1 UTSW 10 53062602 missense probably damaging 0.99
R5116:Slc35f1 UTSW 10 53021895 missense probably benign 0.39
R5378:Slc35f1 UTSW 10 52691061 missense possibly damaging 0.86
R5387:Slc35f1 UTSW 10 53108164 missense probably damaging 1.00
R5500:Slc35f1 UTSW 10 52933222 missense probably damaging 0.99
R5590:Slc35f1 UTSW 10 53108178 missense possibly damaging 0.63
R5743:Slc35f1 UTSW 10 53089450 missense probably benign 0.06
R5916:Slc35f1 UTSW 10 52933221 nonsense probably null
R6985:Slc35f1 UTSW 10 53021911 missense probably benign 0.02
R7068:Slc35f1 UTSW 10 53062500 missense probably damaging 1.00
R7295:Slc35f1 UTSW 10 53062541 missense probably benign 0.00
R7427:Slc35f1 UTSW 10 53089414 missense probably damaging 1.00
R7428:Slc35f1 UTSW 10 53089414 missense probably damaging 1.00
R8334:Slc35f1 UTSW 10 53108148 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- CCACAAAGGTCCTGACACTGTCTTC -3'
(R):5'- ATCTGCTTGGCACAAGTCATCTCTC -3'

Sequencing Primer
(F):5'- CTCCTTACTCCCCAGGACTG -3'
(R):5'- TCTCTCAGGACAAAGTGCTG -3'
Posted On2014-02-11