Incidental Mutation 'R1340:Gfpt2'
ID157010
Institutional Source Beutler Lab
Gene Symbol Gfpt2
Ensembl Gene ENSMUSG00000020363
Gene Nameglutamine fructose-6-phosphate transaminase 2
SynonymsGFAT2
MMRRC Submission 039405-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1340 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location49794178-49838613 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 49832861 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 559 (K559E)
Ref Sequence ENSEMBL: ENSMUSP00000020629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020629]
Predicted Effect probably damaging
Transcript: ENSMUST00000020629
AA Change: K559E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020629
Gene: ENSMUSG00000020363
AA Change: K559E

DomainStartEndE-ValueType
Pfam:GATase_6 72 212 1e-19 PFAM
Pfam:GATase_4 75 206 1.6e-7 PFAM
Pfam:GATase_7 90 209 8.2e-16 PFAM
Pfam:SIS 363 492 1.7e-38 PFAM
Pfam:SIS 534 665 1.2e-29 PFAM
Meta Mutation Damage Score 0.9739 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 89.9%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A T 6: 142,682,855 probably benign Het
Acat3 C T 17: 12,929,677 probably benign Het
Actn1 T C 12: 80,173,144 probably null Het
Adam8 G A 7: 139,991,377 S38F probably damaging Het
Aldh9a1 T G 1: 167,357,344 I275S probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Alms1 G A 6: 85,667,957 probably null Het
Cacna1d A G 14: 30,072,067 V1539A probably damaging Het
Cacna1e A G 1: 154,472,657 L724P probably damaging Het
Ccdc110 A G 8: 45,942,181 T370A probably benign Het
Ccdc9 G A 7: 16,275,390 probably benign Het
Cep120 A T 18: 53,724,391 V334E probably damaging Het
Ces3a C T 8: 105,057,913 P462L probably damaging Het
Cgref1 A G 5: 30,945,346 probably benign Het
Cndp1 G A 18: 84,634,652 probably benign Het
Csrnp3 T A 2: 66,002,396 F81Y probably damaging Het
Ddr2 T C 1: 169,998,084 T316A probably benign Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Epb41l5 A T 1: 119,549,131 *740R probably null Het
Gm2381 A G 7: 42,820,404 Y99H possibly damaging Het
Gsdma2 T C 11: 98,657,649 V242A probably damaging Het
Lrp1b T C 2: 40,702,794 N3771S probably benign Het
Lrriq4 A C 3: 30,650,323 T167P possibly damaging Het
Marc2 T C 1: 184,822,547 T254A probably benign Het
Naip2 G A 13: 100,189,122 L93F possibly damaging Het
Nefh G GNNNNNNNNNNNNNNNNNN 11: 4,941,002 probably benign Het
Nrp1 T C 8: 128,434,355 S321P probably damaging Het
Nt5c1b T C 12: 10,377,276 V342A probably damaging Het
Nt5c3 A G 6: 56,883,033 M273T probably benign Het
Olfr364-ps1 T G 2: 37,146,757 L182V probably benign Het
Olfr449 G A 6: 42,838,009 V43M probably benign Het
Olfr527 A G 7: 140,336,125 T88A probably benign Het
Polr3f A G 2: 144,538,628 H297R probably benign Het
Ptgs2 T G 1: 150,105,477 F504V probably damaging Het
Ptpro C T 6: 137,441,081 P142L possibly damaging Het
Rps17 A G 7: 81,343,733 probably null Het
Ryr1 A G 7: 29,116,012 S132P probably damaging Het
Sacs T C 14: 61,204,509 S1335P probably damaging Het
Senp6 T C 9: 80,122,023 V383A possibly damaging Het
Skint7 T C 4: 111,980,219 F65L probably damaging Het
Slc35f1 T C 10: 53,089,454 Y322H probably damaging Het
Slc38a4 C A 15: 97,010,272 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Sox15 T A 11: 69,655,547 S59T probably damaging Het
Srcap T A 7: 127,560,738 probably benign Het
Txlnb A T 10: 17,842,740 I440F probably damaging Het
Uhrf1bp1 A G 17: 27,894,721 N1289S probably benign Het
Vmn1r178 A G 7: 23,893,856 S37G probably benign Het
Vmn2r75 T C 7: 86,148,590 T672A probably damaging Het
Wscd1 T C 11: 71,768,760 V222A probably benign Het
Other mutations in Gfpt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00934:Gfpt2 APN 11 49809123 missense probably benign 0.00
IGL01451:Gfpt2 APN 11 49807690 splice site probably benign
IGL01490:Gfpt2 APN 11 49827127 splice site probably benign
IGL01550:Gfpt2 APN 11 49824323 splice site probably null
IGL01552:Gfpt2 APN 11 49805005 nonsense probably null
IGL02349:Gfpt2 APN 11 49807703 missense probably benign 0.02
IGL02815:Gfpt2 APN 11 49823257 missense possibly damaging 0.89
R0525:Gfpt2 UTSW 11 49829775 missense probably benign 0.06
R0539:Gfpt2 UTSW 11 49832898 missense probably damaging 1.00
R1055:Gfpt2 UTSW 11 49827211 missense probably damaging 1.00
R1178:Gfpt2 UTSW 11 49823309 missense probably benign 0.42
R2372:Gfpt2 UTSW 11 49807715 missense probably benign 0.00
R4154:Gfpt2 UTSW 11 49835778 splice site probably null
R4476:Gfpt2 UTSW 11 49824342 missense probably benign 0.17
R4679:Gfpt2 UTSW 11 49823737 missense probably benign 0.00
R4863:Gfpt2 UTSW 11 49810970 missense probably benign 0.06
R5113:Gfpt2 UTSW 11 49823799 missense probably damaging 1.00
R5509:Gfpt2 UTSW 11 49827146 missense possibly damaging 0.75
R5830:Gfpt2 UTSW 11 49809061 missense probably benign 0.03
R6435:Gfpt2 UTSW 11 49835651 missense probably benign 0.00
R7079:Gfpt2 UTSW 11 49837751 missense possibly damaging 0.77
R7135:Gfpt2 UTSW 11 49804955 missense probably damaging 1.00
R7261:Gfpt2 UTSW 11 49823251 missense possibly damaging 0.77
R7294:Gfpt2 UTSW 11 49818608 nonsense probably null
R7384:Gfpt2 UTSW 11 49810990 missense possibly damaging 0.56
R7778:Gfpt2 UTSW 11 49824441 missense probably damaging 1.00
R7806:Gfpt2 UTSW 11 49823315 missense probably benign
R7824:Gfpt2 UTSW 11 49824441 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAAGAGAGCTGTCACCACTGTTG -3'
(R):5'- ATCAGTCTCTTGGAGAGCCCTCAC -3'

Sequencing Primer
(F):5'- GGGGCTGCAAGGTTACTATC -3'
(R):5'- TGGCACTTGGCAAAGCAA -3'
Posted On2014-02-11