Mutagenetix > Incidental Mutation

Incidental Mutation 'R1340:Cep120'

157023

Institutional Source

Beutler Lab

Gene Symbol

Cep120

Ensembl Gene

ENSMUSG00000048799

Gene Name

centrosomal protein 120

Synonyms

Ccdc100

MMRRC Submission

039405-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.741) question?

Stock #

R1340 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

53681724-53744547 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 53724391 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 334 (V334E)

Ref Sequence

ENSEMBL: ENSMUSP00000062433 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049811]

AlphaFold

Q7TSG1

Predicted Effect

probably damaging
Transcript: ENSMUST00000049811
AA Change: V334E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000062433
Gene: ENSMUSG00000048799
AA Change: V334E

Domain	Start	End	E-Value	Type
Pfam:C2	9	114	4.8e-5	PFAM
Pfam:DUF3668	118	340	1e-96	PFAM
low complexity region	378	396	N/A	INTRINSIC
Pfam:C2	520	568	1.9e-3	PFAM
low complexity region	632	642	N/A	INTRINSIC
SCOP:d1eq1a_	661	803	2e-4	SMART

Meta Mutation Damage Score

0.1839

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.4%
20x: 89.9%

Validation Efficiency

100% (52/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions in the microtubule-dependent coupling of the nucleus and the centrosome. A similar protein in mouse plays a role in both interkinetic nuclear migration, which is a characteristic pattern of nuclear movement in neural progenitors, and in neural progenitor self-renewal. Mutations in this gene are predicted to result in neurogenic defects. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele show embryonic growth arrest at E8.5 and die during organogenesis exhibiting abnormal direction of heart looping. Primary mouse embryonic fibroblasts lack cilia and either one or both centrioles. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc9	A	T	6: 142,682,855		probably benign	Het
Acat3	C	T	17: 12,929,677		probably benign	Het
Actn1	T	C	12: 80,173,144		probably null	Het
Adam8	G	A	7: 139,991,377	S38F	probably damaging	Het
Aldh9a1	T	G	1: 167,357,344	I275S	probably benign	Het
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
Alms1	G	A	6: 85,667,957		probably null	Het
Cacna1d	A	G	14: 30,072,067	V1539A	probably damaging	Het
Cacna1e	A	G	1: 154,472,657	L724P	probably damaging	Het
Ccdc110	A	G	8: 45,942,181	T370A	probably benign	Het
Ccdc9	G	A	7: 16,275,390		probably benign	Het
Ces3a	C	T	8: 105,057,913	P462L	probably damaging	Het
Cgref1	A	G	5: 30,945,346		probably benign	Het
Cndp1	G	A	18: 84,634,652		probably benign	Het
Csrnp3	T	A	2: 66,002,396	F81Y	probably damaging	Het
Ddr2	T	C	1: 169,998,084	T316A	probably benign	Het
Dync1h1	G	A	12: 110,636,509	E2195K	probably benign	Het
Epb41l5	A	T	1: 119,549,131	*740R	probably null	Het
Gfpt2	A	G	11: 49,832,861	K559E	probably damaging	Het
Gm2381	A	G	7: 42,820,404	Y99H	possibly damaging	Het
Gsdma2	T	C	11: 98,657,649	V242A	probably damaging	Het
Lrp1b	T	C	2: 40,702,794	N3771S	probably benign	Het
Lrriq4	A	C	3: 30,650,323	T167P	possibly damaging	Het
Marc2	T	C	1: 184,822,547	T254A	probably benign	Het
Naip2	G	A	13: 100,189,122	L93F	possibly damaging	Het
Nefh	G	GNNNNNNNNNNNNNNNNNN	11: 4,941,002		probably benign	Het
Nrp1	T	C	8: 128,434,355	S321P	probably damaging	Het
Nt5c1b	T	C	12: 10,377,276	V342A	probably damaging	Het
Nt5c3	A	G	6: 56,883,033	M273T	probably benign	Het
Olfr364-ps1	T	G	2: 37,146,757	L182V	probably benign	Het
Olfr449	G	A	6: 42,838,009	V43M	probably benign	Het
Olfr527	A	G	7: 140,336,125	T88A	probably benign	Het
Polr3f	A	G	2: 144,538,628	H297R	probably benign	Het
Ptgs2	T	G	1: 150,105,477	F504V	probably damaging	Het
Ptpro	C	T	6: 137,441,081	P142L	possibly damaging	Het
Rps17	A	G	7: 81,343,733		probably null	Het
Ryr1	A	G	7: 29,116,012	S132P	probably damaging	Het
Sacs	T	C	14: 61,204,509	S1335P	probably damaging	Het
Senp6	T	C	9: 80,122,023	V383A	possibly damaging	Het
Skint7	T	C	4: 111,980,219	F65L	probably damaging	Het
Slc35f1	T	C	10: 53,089,454	Y322H	probably damaging	Het
Slc38a4	C	A	15: 97,010,272		probably benign	Het
Sned1	G	A	1: 93,281,654	V830M	possibly damaging	Het
Sox15	T	A	11: 69,655,547	S59T	probably damaging	Het
Srcap	T	A	7: 127,560,738		probably benign	Het
Txlnb	A	T	10: 17,842,740	I440F	probably damaging	Het
Uhrf1bp1	A	G	17: 27,894,721	N1289S	probably benign	Het
Vmn1r178	A	G	7: 23,893,856	S37G	probably benign	Het
Vmn2r75	T	C	7: 86,148,590	T672A	probably damaging	Het
Wscd1	T	C	11: 71,768,760	V222A	probably benign	Het

Other mutations in Cep120

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01544:Cep120	APN	18	53685961	missense	probably benign	0.24
IGL01774:Cep120	APN	18	53706830	missense	possibly damaging	0.92
IGL01862:Cep120	APN	18	53714767	missense	probably benign	0.01
IGL01906:Cep120	APN	18	53714912	missense	probably benign
IGL01941:Cep120	APN	18	53723148	missense	probably benign	0.00
IGL02952:Cep120	APN	18	53683228	utr 3 prime	probably benign
IGL03248:Cep120	APN	18	53735772	missense	probably benign	0.04
IGL03379:Cep120	APN	18	53709136	missense	probably benign
R0019:Cep120	UTSW	18	53709047	splice site	probably benign
R0039:Cep120	UTSW	18	53685961	missense	probably benign	0.24
R0763:Cep120	UTSW	18	53721737	missense	probably benign	0.00
R1015:Cep120	UTSW	18	53703121	critical splice donor site	probably null
R1507:Cep120	UTSW	18	53697657	missense	probably damaging	0.99
R1649:Cep120	UTSW	18	53724576	missense	probably damaging	1.00
R1727:Cep120	UTSW	18	53727729	missense	probably benign	0.01
R1739:Cep120	UTSW	18	53719214	critical splice donor site	probably null
R1873:Cep120	UTSW	18	53738488	missense	probably damaging	0.98
R1913:Cep120	UTSW	18	53723286	missense	probably benign	0.26
R1968:Cep120	UTSW	18	53723241	missense	probably benign	0.42
R1995:Cep120	UTSW	18	53740136	missense	probably damaging	1.00
R2042:Cep120	UTSW	18	53735742	missense	possibly damaging	0.50
R2074:Cep120	UTSW	18	53719312	missense	possibly damaging	0.83
R2116:Cep120	UTSW	18	53740136	missense	probably damaging	1.00
R2215:Cep120	UTSW	18	53727635	missense	probably damaging	1.00
R2697:Cep120	UTSW	18	53740125	missense	probably benign	0.00
R3813:Cep120	UTSW	18	53740212	splice site	probably benign
R4012:Cep120	UTSW	18	53738582	missense	probably damaging	0.99
R4368:Cep120	UTSW	18	53685885	splice site	probably null
R4615:Cep120	UTSW	18	53714841	missense	probably damaging	1.00
R4772:Cep120	UTSW	18	53718489	missense	probably damaging	1.00
R4780:Cep120	UTSW	18	53724536	missense	probably benign	0.12
R5195:Cep120	UTSW	18	53721698	missense	probably damaging	1.00
R5991:Cep120	UTSW	18	53721798	missense	probably benign
R6156:Cep120	UTSW	18	53703223	missense	probably benign	0.00
R6188:Cep120	UTSW	18	53724457	missense	probably benign	0.03
R6688:Cep120	UTSW	18	53724536	missense	probably benign	0.12
R6961:Cep120	UTSW	18	53703205	nonsense	probably null
R7143:Cep120	UTSW	18	53683385	missense	probably benign	0.00
R7282:Cep120	UTSW	18	53740089	missense	probably damaging	1.00
R7813:Cep120	UTSW	18	53738506	missense	probably damaging	1.00
R7818:Cep120	UTSW	18	53723103	missense	probably benign
R8677:Cep120	UTSW	18	53738561	missense	possibly damaging	0.90
R8724:Cep120	UTSW	18	53723127	missense	possibly damaging	0.88
R9164:Cep120	UTSW	18	53719246	missense	probably benign	0.02
R9225:Cep120	UTSW	18	53706824	missense	probably benign	0.00
R9300:Cep120	UTSW	18	53719297	missense	probably damaging	0.99
R9312:Cep120	UTSW	18	53727641	missense	probably benign	0.08
R9377:Cep120	UTSW	18	53718520	missense	possibly damaging	0.66
R9390:Cep120	UTSW	18	53706912	nonsense	probably null
R9499:Cep120	UTSW	18	53685961	missense	possibly damaging	0.94
R9551:Cep120	UTSW	18	53685961	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- GGCCCAACGTACAGTCACAATCTG -3'
(R):5'- TCTGCTGTGGAGACCAGTCACTTG -3'

Sequencing Primer
(F):5'- AAGCAGAGTCAGTGGGCTTTC -3'
(R):5'- CCAGTCACTTGGCAGTACAG -3'

Posted On

2014-02-11