Incidental Mutation 'R1341:Nat8f4'
ID157043
Institutional Source Beutler Lab
Gene Symbol Nat8f4
Ensembl Gene ENSMUSG00000068299
Gene NameN-acetyltransferase 8 (GCN5-related) family member 4
Synonyms1700019G17Rik
MMRRC Submission 039406-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R1341 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location85899051-85904884 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 85901424 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 39 (L39Q)
Ref Sequence ENSEMBL: ENSMUSP00000124071 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095757] [ENSMUST00000159755]
Predicted Effect probably benign
Transcript: ENSMUST00000095757
AA Change: L39Q

PolyPhen 2 Score 0.291 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000093430
Gene: ENSMUSG00000068299
AA Change: L39Q

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
Pfam:Acetyltransf_10 75 192 2.5e-11 PFAM
Pfam:Acetyltransf_8 83 200 2.1e-11 PFAM
Pfam:Acetyltransf_7 104 194 3.3e-14 PFAM
Pfam:Acetyltransf_1 111 193 6.3e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159755
AA Change: L39Q

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000124071
Gene: ENSMUSG00000068299
AA Change: L39Q

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
transmembrane domain 60 82 N/A INTRINSIC
low complexity region 117 130 N/A INTRINSIC
Meta Mutation Damage Score 0.2370 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 88.9%
Validation Efficiency 96% (53/55)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp6v0e2 A G 6: 48,540,111 Y75C probably benign Het
C87977 T C 4: 144,207,559 D326G probably damaging Het
Cacna1g A G 11: 94,433,756 L1190P probably damaging Het
Ccdc190 A G 1: 169,930,017 D15G probably damaging Het
Cep126 G T 9: 8,099,776 P919Q possibly damaging Het
Chchd6 A G 6: 89,384,641 V260A probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cramp1l T C 17: 24,977,540 K867E probably damaging Het
Dnah6 A T 6: 73,191,619 N440K probably benign Het
Fbxw15 G A 9: 109,558,246 S227F probably damaging Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Gm17421 A T 12: 113,369,714 noncoding transcript Het
Gm4788 T A 1: 139,732,393 T665S probably damaging Het
Hdac3 A G 18: 37,954,713 V36A probably damaging Het
Hist1h2bl T C 13: 21,716,110 K12E probably benign Het
Hoxa13 CCG CCGCG 6: 52,260,635 probably null Het
Itga10 G A 3: 96,652,495 E489K probably damaging Het
Mgat5b A C 11: 116,978,397 I589L probably benign Het
Mindy4 A G 6: 55,255,616 N348S probably benign Het
Mmp15 A G 8: 95,372,303 D586G probably benign Het
Mmp9 A G 2: 164,949,327 D139G probably damaging Het
Morc2a C A 11: 3,680,216 L471I possibly damaging Het
Mycbp2 T A 14: 103,298,867 probably benign Het
Mylip T A 13: 45,405,936 S105T probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Obscn T C 11: 59,029,372 probably benign Het
Olfr1086 T C 2: 86,677,163 M57V possibly damaging Het
Olfr1337 T C 4: 118,782,382 T68A probably benign Het
Olfr279 G A 15: 98,498,254 V261M possibly damaging Het
Olfr633 T A 7: 103,947,382 V272D possibly damaging Het
Olfr825 G T 10: 130,163,316 D3E probably benign Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Rab11fip1 G T 8: 27,143,360 A1106E probably damaging Het
Rfc1 A G 5: 65,291,194 S363P probably damaging Het
Skint10 A G 4: 112,765,031 probably benign Het
Spen T C 4: 141,469,400 N3595D possibly damaging Het
Swsap1 A G 9: 21,957,154 K241E probably benign Het
Tab1 A G 15: 80,160,114 T448A possibly damaging Het
Tktl1 G T X: 74,197,683 G302V probably damaging Het
Uhrf1bp1 T C 17: 27,877,419 probably benign Het
Usp25 A G 16: 77,115,443 T1017A probably benign Het
Vmn2r78 T A 7: 86,922,269 M429K possibly damaging Het
Wdr49 A T 3: 75,429,333 F356I probably damaging Het
Wnt1 T C 15: 98,791,883 F184L probably damaging Het
Yy1 T C 12: 108,793,519 I36T unknown Het
Zbtb39 A G 10: 127,743,500 I648V possibly damaging Het
Other mutations in Nat8f4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Nat8f4 APN 6 85900987 missense probably benign 0.05
IGL03072:Nat8f4 APN 6 85900854 intron probably benign
R1725:Nat8f4 UTSW 6 85901098 nonsense probably null
R1923:Nat8f4 UTSW 6 85901515 missense probably damaging 1.00
R2258:Nat8f4 UTSW 6 85901225 missense possibly damaging 0.84
R3975:Nat8f4 UTSW 6 85901070 missense possibly damaging 0.62
R4697:Nat8f4 UTSW 6 85901386 missense probably benign 0.01
R4784:Nat8f4 UTSW 6 85901499 missense probably benign 0.03
R4924:Nat8f4 UTSW 6 85901419 missense probably benign 0.03
R4991:Nat8f4 UTSW 6 85901140 missense probably benign 0.30
R6074:Nat8f4 UTSW 6 85901187 missense probably damaging 0.98
R7058:Nat8f4 UTSW 6 85901289 missense possibly damaging 0.73
R7790:Nat8f4 UTSW 6 85900891 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTCAGCTTGCAAACTTGTAGCCAC -3'
(R):5'- TGCGGATGGCTTGACACTTCTC -3'

Sequencing Primer
(F):5'- GTAGCCACGTAATTTCTCCAAG -3'
(R):5'- ACACCTGTGAGTGGAGTCTC -3'
Posted On2014-02-11