Incidental Mutation 'R1341:Mmp15'
ID157048
Institutional Source Beutler Lab
Gene Symbol Mmp15
Ensembl Gene ENSMUSG00000031790
Gene Namematrix metallopeptidase 15
SynonymsMembrane type 2-MMP, MT2-MMP
MMRRC Submission 039406-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1341 (G1)
Quality Score168
Status Validated
Chromosome8
Chromosomal Location95352268-95375080 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 95372303 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 586 (D586G)
Ref Sequence ENSEMBL: ENSMUSP00000034243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034243]
Predicted Effect probably benign
Transcript: ENSMUST00000034243
AA Change: D586G

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000034243
Gene: ENSMUSG00000031790
AA Change: D586G

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
Pfam:PG_binding_1 42 102 3.2e-13 PFAM
ZnMc 131 301 5.31e-59 SMART
low complexity region 306 353 N/A INTRINSIC
HX 370 413 5.92e-8 SMART
HX 415 459 2.31e-10 SMART
HX 462 508 2.98e-13 SMART
HX 510 555 2.01e-10 SMART
Pfam:DUF3377 586 657 1.2e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212235
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 88.9%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded preproprotein undergoes proteolytic processing to generate a mature, zinc-dependent endopeptidase enzyme. A deficiency of the encoded protein in mice is compatible with normal development and postnatal growth. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp6v0e2 A G 6: 48,540,111 Y75C probably benign Het
C87977 T C 4: 144,207,559 D326G probably damaging Het
Cacna1g A G 11: 94,433,756 L1190P probably damaging Het
Ccdc190 A G 1: 169,930,017 D15G probably damaging Het
Cep126 G T 9: 8,099,776 P919Q possibly damaging Het
Chchd6 A G 6: 89,384,641 V260A probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cramp1l T C 17: 24,977,540 K867E probably damaging Het
Dnah6 A T 6: 73,191,619 N440K probably benign Het
Fbxw15 G A 9: 109,558,246 S227F probably damaging Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Gm17421 A T 12: 113,369,714 noncoding transcript Het
Gm4788 T A 1: 139,732,393 T665S probably damaging Het
Hdac3 A G 18: 37,954,713 V36A probably damaging Het
Hist1h2bl T C 13: 21,716,110 K12E probably benign Het
Hoxa13 CCG CCGCG 6: 52,260,635 probably null Het
Itga10 G A 3: 96,652,495 E489K probably damaging Het
Mgat5b A C 11: 116,978,397 I589L probably benign Het
Mindy4 A G 6: 55,255,616 N348S probably benign Het
Mmp9 A G 2: 164,949,327 D139G probably damaging Het
Morc2a C A 11: 3,680,216 L471I possibly damaging Het
Mycbp2 T A 14: 103,298,867 probably benign Het
Mylip T A 13: 45,405,936 S105T probably damaging Het
Nat8f4 A T 6: 85,901,424 L39Q probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Obscn T C 11: 59,029,372 probably benign Het
Olfr1086 T C 2: 86,677,163 M57V possibly damaging Het
Olfr1337 T C 4: 118,782,382 T68A probably benign Het
Olfr279 G A 15: 98,498,254 V261M possibly damaging Het
Olfr633 T A 7: 103,947,382 V272D possibly damaging Het
Olfr825 G T 10: 130,163,316 D3E probably benign Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Rab11fip1 G T 8: 27,143,360 A1106E probably damaging Het
Rfc1 A G 5: 65,291,194 S363P probably damaging Het
Skint10 A G 4: 112,765,031 probably benign Het
Spen T C 4: 141,469,400 N3595D possibly damaging Het
Swsap1 A G 9: 21,957,154 K241E probably benign Het
Tab1 A G 15: 80,160,114 T448A possibly damaging Het
Tktl1 G T X: 74,197,683 G302V probably damaging Het
Uhrf1bp1 T C 17: 27,877,419 probably benign Het
Usp25 A G 16: 77,115,443 T1017A probably benign Het
Vmn2r78 T A 7: 86,922,269 M429K possibly damaging Het
Wdr49 A T 3: 75,429,333 F356I probably damaging Het
Wnt1 T C 15: 98,791,883 F184L probably damaging Het
Yy1 T C 12: 108,793,519 I36T unknown Het
Zbtb39 A G 10: 127,743,500 I648V possibly damaging Het
Other mutations in Mmp15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01467:Mmp15 APN 8 95366331 missense probably benign 0.31
IGL03001:Mmp15 APN 8 95368217 missense probably damaging 0.97
R0147:Mmp15 UTSW 8 95372317 missense probably benign 0.18
R0148:Mmp15 UTSW 8 95372317 missense probably benign 0.18
R0437:Mmp15 UTSW 8 95370772 missense probably benign 0.04
R0465:Mmp15 UTSW 8 95367998 missense probably damaging 1.00
R0548:Mmp15 UTSW 8 95372351 missense probably damaging 1.00
R0574:Mmp15 UTSW 8 95365401 missense possibly damaging 0.73
R0685:Mmp15 UTSW 8 95372134 missense possibly damaging 0.81
R0763:Mmp15 UTSW 8 95368228 missense probably benign 0.01
R1428:Mmp15 UTSW 8 95369562 missense probably benign 0.34
R1840:Mmp15 UTSW 8 95365420 missense probably damaging 1.00
R2061:Mmp15 UTSW 8 95370779 missense possibly damaging 0.91
R2219:Mmp15 UTSW 8 95370173 missense probably benign 0.38
R4760:Mmp15 UTSW 8 95368196 missense possibly damaging 0.61
R4762:Mmp15 UTSW 8 95372330 missense probably benign 0.00
R5233:Mmp15 UTSW 8 95371068 missense probably benign 0.08
R5394:Mmp15 UTSW 8 95366404 missense probably damaging 0.96
R5502:Mmp15 UTSW 8 95368184 missense possibly damaging 0.96
R5543:Mmp15 UTSW 8 95368101 missense possibly damaging 0.85
R6027:Mmp15 UTSW 8 95372176 missense probably benign 0.00
R6341:Mmp15 UTSW 8 95365463 critical splice donor site probably null
R6720:Mmp15 UTSW 8 95365314 missense probably benign 0.22
R7788:Mmp15 UTSW 8 95368148 missense probably damaging 1.00
R8033:Mmp15 UTSW 8 95367962 missense probably benign 0.01
R8679:Mmp15 UTSW 8 95366354 missense possibly damaging 0.83
R8791:Mmp15 UTSW 8 95369660 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCCGGAAGATCCAGGACCATTTAAC -3'
(R):5'- TGCATCTGCACCAGAGCAAAGG -3'

Sequencing Primer
(F):5'- ATCCAGGACCGTTTAACGTG -3'
(R):5'- GGCCAGGCCCAGAATACAG -3'
Posted On2014-02-11