Incidental Mutation 'R1341:Mmp15'
ID 157048
Institutional Source Beutler Lab
Gene Symbol Mmp15
Ensembl Gene ENSMUSG00000031790
Gene Name matrix metallopeptidase 15
Synonyms Membrane type 2-MMP, MT2-MMP
MMRRC Submission 039406-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1341 (G1)
Quality Score 168
Status Validated
Chromosome 8
Chromosomal Location 95352268-95375080 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 95372303 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 586 (D586G)
Ref Sequence ENSEMBL: ENSMUSP00000034243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034243]
AlphaFold O54732
Predicted Effect probably benign
Transcript: ENSMUST00000034243
AA Change: D586G

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000034243
Gene: ENSMUSG00000031790
AA Change: D586G

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
Pfam:PG_binding_1 42 102 3.2e-13 PFAM
ZnMc 131 301 5.31e-59 SMART
low complexity region 306 353 N/A INTRINSIC
HX 370 413 5.92e-8 SMART
HX 415 459 2.31e-10 SMART
HX 462 508 2.98e-13 SMART
HX 510 555 2.01e-10 SMART
Pfam:DUF3377 586 657 1.2e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212235
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 88.9%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded preproprotein undergoes proteolytic processing to generate a mature, zinc-dependent endopeptidase enzyme. A deficiency of the encoded protein in mice is compatible with normal development and postnatal growth. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp6v0e2 A G 6: 48,540,111 (GRCm38) Y75C probably benign Het
C87977 T C 4: 144,207,559 (GRCm38) D326G probably damaging Het
Cacna1g A G 11: 94,433,756 (GRCm38) L1190P probably damaging Het
Ccdc190 A G 1: 169,930,017 (GRCm38) D15G probably damaging Het
Cep126 G T 9: 8,099,776 (GRCm38) P919Q possibly damaging Het
Chchd6 A G 6: 89,384,641 (GRCm38) V260A probably benign Het
Col1a2 G A 6: 4,518,822 (GRCm38) probably benign Het
Cramp1l T C 17: 24,977,540 (GRCm38) K867E probably damaging Het
Dnah6 A T 6: 73,191,619 (GRCm38) N440K probably benign Het
Fbxw15 G A 9: 109,558,246 (GRCm38) S227F probably damaging Het
Gjb3 G A 4: 127,326,431 (GRCm38) R103W probably damaging Het
Gm17421 A T 12: 113,369,714 (GRCm38) noncoding transcript Het
Gm4788 T A 1: 139,732,393 (GRCm38) T665S probably damaging Het
Hdac3 A G 18: 37,954,713 (GRCm38) V36A probably damaging Het
Hist1h2bl T C 13: 21,716,110 (GRCm38) K12E probably benign Het
Hoxa13 CCG CCGCG 6: 52,260,635 (GRCm38) probably null Het
Itga10 G A 3: 96,652,495 (GRCm38) E489K probably damaging Het
Mgat5b A C 11: 116,978,397 (GRCm38) I589L probably benign Het
Mindy4 A G 6: 55,255,616 (GRCm38) N348S probably benign Het
Mmp9 A G 2: 164,949,327 (GRCm38) D139G probably damaging Het
Morc2a C A 11: 3,680,216 (GRCm38) L471I possibly damaging Het
Mycbp2 T A 14: 103,298,867 (GRCm38) probably benign Het
Mylip T A 13: 45,405,936 (GRCm38) S105T probably damaging Het
Nat8f4 A T 6: 85,901,424 (GRCm38) L39Q probably damaging Het
Nrbp1 T A 5: 31,245,813 (GRCm38) I210N probably damaging Het
Obscn T C 11: 59,029,372 (GRCm38) probably benign Het
Olfr1086 T C 2: 86,677,163 (GRCm38) M57V possibly damaging Het
Olfr1337 T C 4: 118,782,382 (GRCm38) T68A probably benign Het
Olfr279 G A 15: 98,498,254 (GRCm38) V261M possibly damaging Het
Olfr633 T A 7: 103,947,382 (GRCm38) V272D possibly damaging Het
Olfr825 G T 10: 130,163,316 (GRCm38) D3E probably benign Het
Prl2c2 G C 13: 13,002,201 (GRCm38) T47R probably damaging Het
Rab11fip1 G T 8: 27,143,360 (GRCm38) A1106E probably damaging Het
Rfc1 A G 5: 65,291,194 (GRCm38) S363P probably damaging Het
Skint10 A G 4: 112,765,031 (GRCm38) probably benign Het
Spen T C 4: 141,469,400 (GRCm38) N3595D possibly damaging Het
Swsap1 A G 9: 21,957,154 (GRCm38) K241E probably benign Het
Tab1 A G 15: 80,160,114 (GRCm38) T448A possibly damaging Het
Tktl1 G T X: 74,197,683 (GRCm38) G302V probably damaging Het
Uhrf1bp1 T C 17: 27,877,419 (GRCm38) probably benign Het
Usp25 A G 16: 77,115,443 (GRCm38) T1017A probably benign Het
Vmn2r78 T A 7: 86,922,269 (GRCm38) M429K possibly damaging Het
Wdr49 A T 3: 75,429,333 (GRCm38) F356I probably damaging Het
Wnt1 T C 15: 98,791,883 (GRCm38) F184L probably damaging Het
Yy1 T C 12: 108,793,519 (GRCm38) I36T unknown Het
Zbtb39 A G 10: 127,743,500 (GRCm38) I648V possibly damaging Het
Other mutations in Mmp15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01467:Mmp15 APN 8 95,366,331 (GRCm38) missense probably benign 0.31
IGL03001:Mmp15 APN 8 95,368,217 (GRCm38) missense probably damaging 0.97
R0147:Mmp15 UTSW 8 95,372,317 (GRCm38) missense probably benign 0.18
R0148:Mmp15 UTSW 8 95,372,317 (GRCm38) missense probably benign 0.18
R0437:Mmp15 UTSW 8 95,370,772 (GRCm38) missense probably benign 0.04
R0465:Mmp15 UTSW 8 95,367,998 (GRCm38) missense probably damaging 1.00
R0548:Mmp15 UTSW 8 95,372,351 (GRCm38) missense probably damaging 1.00
R0574:Mmp15 UTSW 8 95,365,401 (GRCm38) missense possibly damaging 0.73
R0685:Mmp15 UTSW 8 95,372,134 (GRCm38) missense possibly damaging 0.81
R0763:Mmp15 UTSW 8 95,368,228 (GRCm38) missense probably benign 0.01
R1428:Mmp15 UTSW 8 95,369,562 (GRCm38) missense probably benign 0.34
R1840:Mmp15 UTSW 8 95,365,420 (GRCm38) missense probably damaging 1.00
R2061:Mmp15 UTSW 8 95,370,779 (GRCm38) missense possibly damaging 0.91
R2219:Mmp15 UTSW 8 95,370,173 (GRCm38) missense probably benign 0.38
R4760:Mmp15 UTSW 8 95,368,196 (GRCm38) missense possibly damaging 0.61
R4762:Mmp15 UTSW 8 95,372,330 (GRCm38) missense probably benign 0.00
R5233:Mmp15 UTSW 8 95,371,068 (GRCm38) missense probably benign 0.08
R5394:Mmp15 UTSW 8 95,366,404 (GRCm38) missense probably damaging 0.96
R5502:Mmp15 UTSW 8 95,368,184 (GRCm38) missense possibly damaging 0.96
R5543:Mmp15 UTSW 8 95,368,101 (GRCm38) missense possibly damaging 0.85
R6027:Mmp15 UTSW 8 95,372,176 (GRCm38) missense probably benign 0.00
R6341:Mmp15 UTSW 8 95,365,463 (GRCm38) critical splice donor site probably null
R6720:Mmp15 UTSW 8 95,365,314 (GRCm38) missense probably benign 0.22
R7788:Mmp15 UTSW 8 95,368,148 (GRCm38) missense probably damaging 1.00
R8033:Mmp15 UTSW 8 95,367,962 (GRCm38) missense probably benign 0.01
R8679:Mmp15 UTSW 8 95,366,354 (GRCm38) missense possibly damaging 0.83
R8791:Mmp15 UTSW 8 95,369,660 (GRCm38) nonsense probably null
R9028:Mmp15 UTSW 8 95,369,688 (GRCm38) missense probably benign 0.01
R9227:Mmp15 UTSW 8 95,366,331 (GRCm38) missense probably benign 0.06
R9230:Mmp15 UTSW 8 95,366,331 (GRCm38) missense probably benign 0.06
R9350:Mmp15 UTSW 8 95,366,374 (GRCm38) missense probably damaging 0.97
R9632:Mmp15 UTSW 8 95,372,103 (GRCm38) critical splice acceptor site probably null
R9695:Mmp15 UTSW 8 95,370,786 (GRCm38) missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- GCCGGAAGATCCAGGACCATTTAAC -3'
(R):5'- TGCATCTGCACCAGAGCAAAGG -3'

Sequencing Primer
(F):5'- ATCCAGGACCGTTTAACGTG -3'
(R):5'- GGCCAGGCCCAGAATACAG -3'
Posted On 2014-02-11