Incidental Mutation 'R1341:Morc2a'
ID157054
Institutional Source Beutler Lab
Gene Symbol Morc2a
Ensembl Gene ENSMUSG00000034543
Gene Namemicrorchidia 2A
SynonymsZcwcc1, 8430403M08Rik
MMRRC Submission 039406-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1341 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location3649494-3690477 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 3680216 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 471 (L471I)
Ref Sequence ENSEMBL: ENSMUSP00000094176 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093389] [ENSMUST00000096441]
Predicted Effect possibly damaging
Transcript: ENSMUST00000093389
AA Change: L471I

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000091087
Gene: ENSMUSG00000034543
AA Change: L471I

DomainStartEndE-ValueType
HATPase_c 24 134 5.35e0 SMART
coiled coil region 285 322 N/A INTRINSIC
low complexity region 403 416 N/A INTRINSIC
Pfam:zf-CW 495 542 5.1e-18 PFAM
coiled coil region 555 583 N/A INTRINSIC
low complexity region 600 618 N/A INTRINSIC
low complexity region 678 704 N/A INTRINSIC
low complexity region 714 729 N/A INTRINSIC
coiled coil region 742 776 N/A INTRINSIC
coiled coil region 966 1011 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000096441
AA Change: L471I

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000094176
Gene: ENSMUSG00000034543
AA Change: L471I

DomainStartEndE-ValueType
HATPase_c 24 134 5.35e0 SMART
coiled coil region 285 322 N/A INTRINSIC
low complexity region 403 416 N/A INTRINSIC
Pfam:zf-CW 494 543 1.7e-19 PFAM
coiled coil region 555 583 N/A INTRINSIC
low complexity region 600 618 N/A INTRINSIC
low complexity region 678 704 N/A INTRINSIC
low complexity region 714 729 N/A INTRINSIC
coiled coil region 742 776 N/A INTRINSIC
coiled coil region 966 1011 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126035
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128666
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131517
Meta Mutation Damage Score 0.0712 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 88.9%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Microrchidia (MORC) protein superfamily. The encoded protein is known to regulate the condensation of heterochromatin in response to DNA damage and play a role in repressing transcription. The protein has been found to regulate the activity of ATP citrate lyase via specific interaction with this enzyme in the cytosol of lipogenic breast cancer cells. The protein also plays a role in lipogenesis and adipocyte differentiation. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp6v0e2 A G 6: 48,540,111 Y75C probably benign Het
C87977 T C 4: 144,207,559 D326G probably damaging Het
Cacna1g A G 11: 94,433,756 L1190P probably damaging Het
Ccdc190 A G 1: 169,930,017 D15G probably damaging Het
Cep126 G T 9: 8,099,776 P919Q possibly damaging Het
Chchd6 A G 6: 89,384,641 V260A probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cramp1l T C 17: 24,977,540 K867E probably damaging Het
Dnah6 A T 6: 73,191,619 N440K probably benign Het
Fbxw15 G A 9: 109,558,246 S227F probably damaging Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Gm17421 A T 12: 113,369,714 noncoding transcript Het
Gm4788 T A 1: 139,732,393 T665S probably damaging Het
Hdac3 A G 18: 37,954,713 V36A probably damaging Het
Hist1h2bl T C 13: 21,716,110 K12E probably benign Het
Hoxa13 CCG CCGCG 6: 52,260,635 probably null Het
Itga10 G A 3: 96,652,495 E489K probably damaging Het
Mgat5b A C 11: 116,978,397 I589L probably benign Het
Mindy4 A G 6: 55,255,616 N348S probably benign Het
Mmp15 A G 8: 95,372,303 D586G probably benign Het
Mmp9 A G 2: 164,949,327 D139G probably damaging Het
Mycbp2 T A 14: 103,298,867 probably benign Het
Mylip T A 13: 45,405,936 S105T probably damaging Het
Nat8f4 A T 6: 85,901,424 L39Q probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Obscn T C 11: 59,029,372 probably benign Het
Olfr1086 T C 2: 86,677,163 M57V possibly damaging Het
Olfr1337 T C 4: 118,782,382 T68A probably benign Het
Olfr279 G A 15: 98,498,254 V261M possibly damaging Het
Olfr633 T A 7: 103,947,382 V272D possibly damaging Het
Olfr825 G T 10: 130,163,316 D3E probably benign Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Rab11fip1 G T 8: 27,143,360 A1106E probably damaging Het
Rfc1 A G 5: 65,291,194 S363P probably damaging Het
Skint10 A G 4: 112,765,031 probably benign Het
Spen T C 4: 141,469,400 N3595D possibly damaging Het
Swsap1 A G 9: 21,957,154 K241E probably benign Het
Tab1 A G 15: 80,160,114 T448A possibly damaging Het
Tktl1 G T X: 74,197,683 G302V probably damaging Het
Uhrf1bp1 T C 17: 27,877,419 probably benign Het
Usp25 A G 16: 77,115,443 T1017A probably benign Het
Vmn2r78 T A 7: 86,922,269 M429K possibly damaging Het
Wdr49 A T 3: 75,429,333 F356I probably damaging Het
Wnt1 T C 15: 98,791,883 F184L probably damaging Het
Yy1 T C 12: 108,793,519 I36T unknown Het
Zbtb39 A G 10: 127,743,500 I648V possibly damaging Het
Other mutations in Morc2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00543:Morc2a APN 11 3680283 missense probably damaging 0.99
IGL00914:Morc2a APN 11 3668844 splice site probably null
IGL01081:Morc2a APN 11 3688149 missense probably damaging 1.00
IGL01092:Morc2a APN 11 3684042 missense probably benign 0.00
IGL01292:Morc2a APN 11 3688175 missense probably damaging 1.00
IGL01326:Morc2a APN 11 3681775 missense probably benign 0.03
IGL01526:Morc2a APN 11 3650428 missense probably benign 0.00
IGL01651:Morc2a APN 11 3658727 critical splice donor site probably null
IGL02860:Morc2a APN 11 3661821 splice site probably benign
IGL03372:Morc2a APN 11 3681813 splice site probably benign
R0136:Morc2a UTSW 11 3685907 intron probably null
R0267:Morc2a UTSW 11 3678567 missense probably benign 0.03
R0279:Morc2a UTSW 11 3683989 missense probably benign 0.09
R0556:Morc2a UTSW 11 3681809 critical splice donor site probably null
R1084:Morc2a UTSW 11 3650454 splice site probably benign
R1148:Morc2a UTSW 11 3678557 missense probably benign 0.00
R1148:Morc2a UTSW 11 3678557 missense probably benign 0.00
R1460:Morc2a UTSW 11 3683794 missense probably benign 0.01
R1493:Morc2a UTSW 11 3678557 missense probably benign 0.00
R1665:Morc2a UTSW 11 3675885 missense probably benign 0.00
R1668:Morc2a UTSW 11 3675885 missense probably benign 0.00
R1669:Morc2a UTSW 11 3675885 missense probably benign 0.00
R1812:Morc2a UTSW 11 3685831 missense probably damaging 0.98
R2132:Morc2a UTSW 11 3679787 missense possibly damaging 0.89
R2133:Morc2a UTSW 11 3680302 nonsense probably null
R2200:Morc2a UTSW 11 3683919 missense probably benign 0.00
R2698:Morc2a UTSW 11 3685400 missense probably damaging 1.00
R3236:Morc2a UTSW 11 3683612 missense probably benign
R3698:Morc2a UTSW 11 3679672 nonsense probably null
R3743:Morc2a UTSW 11 3683700 missense possibly damaging 0.46
R4119:Morc2a UTSW 11 3683868 missense probably benign 0.00
R4898:Morc2a UTSW 11 3676664 nonsense probably null
R5148:Morc2a UTSW 11 3689084 missense probably damaging 1.00
R5228:Morc2a UTSW 11 3685439 missense probably damaging 0.96
R5395:Morc2a UTSW 11 3688232 missense possibly damaging 0.94
R5808:Morc2a UTSW 11 3683781 missense probably benign 0.00
R5942:Morc2a UTSW 11 3679936 missense probably damaging 1.00
R6634:Morc2a UTSW 11 3672376 critical splice donor site probably null
R7056:Morc2a UTSW 11 3675925 missense probably damaging 1.00
R7537:Morc2a UTSW 11 3683566 nonsense probably null
R8014:Morc2a UTSW 11 3677419 missense probably damaging 1.00
RF013:Morc2a UTSW 11 3676191 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TGGTAATGTGACCAGGCCACTAGG -3'
(R):5'- AGATTGCTCACACAGCCACTGC -3'

Sequencing Primer
(F):5'- ACTAGGCCTCAGCTTCTCTT -3'
(R):5'- CCTTGTGGAACTCAAGTTCAAGTC -3'
Posted On2014-02-11